ID: 1097102007

View in Genome Browser
Species Human (GRCh38)
Location 12:56596482-56596504
Sequence CTAGGGAAAGAGATGGAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 404}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097101999_1097102007 -4 Left 1097101999 12:56596463-56596485 CCATATGAGTGCCTGGTCCCTAG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404
1097101998_1097102007 -1 Left 1097101998 12:56596460-56596482 CCGCCATATGAGTGCCTGGTCCC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404
1097101997_1097102007 0 Left 1097101997 12:56596459-56596481 CCCGCCATATGAGTGCCTGGTCC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404
1097101994_1097102007 4 Left 1097101994 12:56596455-56596477 CCACCCCGCCATATGAGTGCCTG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404
1097101992_1097102007 6 Left 1097101992 12:56596453-56596475 CCCCACCCCGCCATATGAGTGCC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404
1097101993_1097102007 5 Left 1097101993 12:56596454-56596476 CCCACCCCGCCATATGAGTGCCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404
1097101996_1097102007 1 Left 1097101996 12:56596458-56596480 CCCCGCCATATGAGTGCCTGGTC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG 0: 1
1: 1
2: 3
3: 41
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097102007 Original CRISPR CTAGGGAAAGAGATGGAGCT GGG Exonic
900692366 1:3988254-3988276 TTAGGGAAAGTGTTGGAGCCTGG - Intergenic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
901156780 1:7145537-7145559 CTTGGGAATGAGCTGGAGCTGGG + Intronic
901423753 1:9168003-9168025 CTAGAGACAGGGCTGGAGCTGGG + Intergenic
901966406 1:12871361-12871383 GTAGGGACATAGATGAAGCTGGG + Intronic
902570894 1:17346501-17346523 CCATGGAAAGTGCTGGAGCTGGG - Intronic
902973964 1:20075294-20075316 CTGGCCAAAGAGATGGAGCTGGG - Intronic
903971860 1:27124072-27124094 CCAGGGATAGAGATGGAGTGGGG - Intronic
906693796 1:47810761-47810783 TTAGGGGAAGAGAGGGAGCAGGG + Intronic
906934314 1:50198637-50198659 CAAAGGAATGAGATAGAGCTAGG - Intronic
907747449 1:57227484-57227506 CTAGGGAAAGAAGTGGAGGCAGG + Intronic
909919839 1:81367514-81367536 GCAGGGACATAGATGGAGCTGGG - Intronic
910899885 1:92108711-92108733 CAAGGGAAAGAAGTGCAGCTGGG + Intronic
911091142 1:94018142-94018164 CTATGGAGAGAGATGTAGCTAGG - Intronic
911507144 1:98767406-98767428 CTAGAGACAGAAATGTAGCTGGG + Intergenic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
912528462 1:110302878-110302900 CAAGGGACAGAGAAGGAGTTGGG + Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
915838169 1:159194705-159194727 CCAGGAAAATACATGGAGCTGGG - Intronic
916015206 1:160743410-160743432 CTGTGGAAAGATATGCAGCTGGG - Intronic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
916762882 1:167832969-167832991 CCAGGGTAAGGGAAGGAGCTGGG - Exonic
917290425 1:173466967-173466989 TTAGGGACATGGATGGAGCTGGG + Intergenic
917609552 1:176673041-176673063 CTAGGGAAAGAGAGGTTTCTGGG + Intronic
917900151 1:179534162-179534184 TTAGGGAAATAGATGAAACTAGG + Intronic
918016100 1:180633525-180633547 ACAGGGAAAGAGATGCAGGTAGG + Intronic
918906617 1:190504701-190504723 GCAGGGAAATGGATGGAGCTAGG - Intergenic
919677718 1:200401967-200401989 CTAGGTAAAAAGATGTAGGTTGG + Intergenic
919857775 1:201717500-201717522 CTAGGGAAGGAGATAGGGCCAGG - Intronic
920267417 1:204734444-204734466 GCAGGGACAGAGAGGGAGCTGGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
922090979 1:222394808-222394830 ATAGAGACAGAGATGGAGTTCGG - Intergenic
922204811 1:223436991-223437013 GTAGGGCAAGAGATGGGGATAGG + Intergenic
922205416 1:223442218-223442240 CTAAGGAAAGGGATGGAGCATGG - Intergenic
922724927 1:227918294-227918316 CTGGGGAAAGAGGAGGACCTGGG - Intergenic
922854180 1:228760149-228760171 GTGGGCAAAGAGATGGAGTTAGG + Intergenic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
923048014 1:230369574-230369596 ATGGGGGAAGAGATGGAGCCAGG - Intronic
924086238 1:240454731-240454753 TTAGGGATAGAGAAGGGGCTGGG + Intronic
924308370 1:242715143-242715165 ATAGGGAGAGAGATGAGGCTGGG - Intergenic
1063471025 10:6285526-6285548 TTAAGTAAAGAGATTGAGCTGGG - Intergenic
1065822922 10:29542962-29542984 CCAGAGACAGAGCTGGAGCTTGG - Intronic
1066143813 10:32535610-32535632 CTAGGTAAAGAGAAGGGGCTTGG + Intronic
1066340621 10:34529371-34529393 CTAGGGAAAGAAAAGTAGCATGG + Intronic
1067027088 10:42852624-42852646 ATAGGCAAAGAGATGAGGCTTGG - Intergenic
1067297229 10:44981874-44981896 CTAGGGAAACCGAGGGAGGTTGG + Intronic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067780016 10:49195121-49195143 ATAGGGAAAGAAATGAAGCCAGG - Intergenic
1068092976 10:52455451-52455473 CTAGGCAAGGAGATGGGGTTTGG - Intergenic
1068879660 10:62035149-62035171 CTAGGGAAGGTGCTGGAGATAGG + Intronic
1069868137 10:71516738-71516760 CTAGTCAAAGGGATGGAGCCAGG + Intronic
1069921569 10:71818861-71818883 CTGAGGAAAGCGATGGGGCTTGG + Intronic
1070346406 10:75546958-75546980 TTTGGGAAAGTGGTGGAGCTAGG + Intronic
1070984368 10:80675481-80675503 CTAGGGAGAGGGAAAGAGCTGGG - Intergenic
1071462532 10:85912574-85912596 GTAAGGAATGAGAGGGAGCTGGG + Intronic
1072936418 10:99717755-99717777 CCAGGGAGAGTGATGGAGATGGG - Intronic
1073754837 10:106570665-106570687 TTAGGAAAAAAGATGGGGCTGGG - Intergenic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1075224416 10:120613529-120613551 CTAAGAAAAGCAATGGAGCTAGG - Intergenic
1075355731 10:121772646-121772668 TTACTGAAAGATATGGAGCTTGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1076623146 10:131805920-131805942 CGAGGGAAAGAGGGGGTGCTGGG - Intergenic
1078363276 11:10686690-10686712 AGATGGAAAGAGATGGGGCTTGG + Intronic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079015187 11:16862750-16862772 GTAGGGGAAGAGATGGTGATGGG - Intronic
1079506267 11:21155796-21155818 CAAGGGAAGGATATGGAGTTGGG + Intronic
1080072689 11:28108498-28108520 CTAGGGGGAGAGGTGGAGTTTGG + Intronic
1080301689 11:30791629-30791651 CAGGGAAAAGAGATGGGGCTGGG + Intergenic
1080301986 11:30794805-30794827 CAAGGAAAAGAGATGGGGCTGGG - Intergenic
1080721388 11:34852613-34852635 GCAGGGACATAGATGGAGCTGGG + Intergenic
1081543898 11:44056111-44056133 CTAGGGAAGGAGGAGGAGCCAGG + Intronic
1081772893 11:45660721-45660743 CTAGGGGAGGAGATGGAGGGGGG - Intronic
1082556273 11:54566445-54566467 GTAGAGAAAGAGATAGAGGTAGG - Intergenic
1082843679 11:57710446-57710468 TTAGGGAGAGAGATGAAGCTGGG - Intronic
1083813370 11:65117813-65117835 CTAGGGAAAGGGGTGGGGCTTGG - Intergenic
1083829647 11:65223423-65223445 TCAGGGAAAGCGAGGGAGCTCGG - Intergenic
1084368592 11:68720863-68720885 CTAGGGAATGAGATTCAGATTGG - Intronic
1086039342 11:82456655-82456677 ATAGGAAAACAGATGGATCTGGG - Intergenic
1088313127 11:108481217-108481239 CAAGAGAAAGAAAAGGAGCTTGG - Exonic
1088348772 11:108861192-108861214 CAAGGGAGAGAGATGTAGCCTGG - Intronic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089367697 11:117931225-117931247 CTAGGGAAAGAGCTCAGGCTTGG + Intergenic
1089500889 11:118930550-118930572 CTAGGGAAGGAGATCGTTCTGGG + Intronic
1089528665 11:119112871-119112893 TTAGGTAAAGAGAAGGAGCCTGG + Exonic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1091004343 11:131939022-131939044 CTCGGGAAAGAGATGAGACTTGG + Intronic
1093471480 12:19506600-19506622 CTAGGGCAGGAGGTGGAGGTAGG - Intronic
1094384361 12:29877950-29877972 TTAGGGAAAGAGAGTGATCTAGG - Intergenic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1095925042 12:47569989-47570011 TTTGGGGAAGAGCTGGAGCTGGG - Intergenic
1096426793 12:51510751-51510773 CTAGAGAAAGAGATGGCACCAGG + Exonic
1096445101 12:51682596-51682618 TTAGGTAATGAGATGGAACTTGG + Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097785634 12:63755824-63755846 CTAGGGAAAGGTATGAAGGTGGG - Intergenic
1098196160 12:68004320-68004342 CTGGGGAGAGAGAGGAAGCTGGG - Intergenic
1098236219 12:68420976-68420998 ATTGGGAAAGAGAGAGAGCTAGG - Intergenic
1098562338 12:71888688-71888710 AGAGGGAAAGAGAGAGAGCTTGG + Intronic
1101912490 12:108870689-108870711 CAAGGGAGAGAGATGAAGCAGGG + Intronic
1102940260 12:116934964-116934986 CAGGGGTTAGAGATGGAGCTGGG - Intronic
1103193695 12:119024276-119024298 CTCGGGAAAAACTTGGAGCTGGG - Intronic
1103371367 12:120421990-120422012 CTGGGGAAAGATTTGGTGCTGGG + Intergenic
1105844072 13:24279804-24279826 CGAGGGAAAGTCATGGAGCCTGG - Intronic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1106350731 13:28928008-28928030 ATAGGGAAATAAATGGTGCTGGG + Intronic
1107984231 13:45761152-45761174 CTAGGCATAGAGAGGAAGCTCGG + Intergenic
1110747158 13:79067648-79067670 ATAGGGAAAGAAAGGGAGCAAGG + Intergenic
1110780139 13:79455699-79455721 CTGGGGAATGAGATGGAATTGGG + Intergenic
1110879961 13:80559407-80559429 CTTGGGACAGAGATTGAGCCTGG + Intergenic
1111159759 13:84379153-84379175 AGAGGGAAAGAGATGGAAATGGG - Intergenic
1111859343 13:93682246-93682268 CTAGGGAAAGTGAAGGAACAAGG + Intronic
1112963231 13:105154487-105154509 AGAAGGAAAGAGATGGAGGTGGG + Intergenic
1113151335 13:107267392-107267414 GGAGGGAAGGAGATGGAGGTGGG + Intronic
1113580281 13:111423787-111423809 CTGGGGAAAGATATGGATTTTGG + Intergenic
1114626277 14:24132157-24132179 CCAGGGTGGGAGATGGAGCTTGG + Intronic
1115518147 14:34205972-34205994 CAAGTGATAGAGGTGGAGCTAGG - Intronic
1115714495 14:36087910-36087932 CTAGGGAATGAGTTGGAAGTAGG - Intergenic
1117406334 14:55407789-55407811 ATAGGGGAAAAGATGGAGGTGGG + Intronic
1117515438 14:56495947-56495969 GTAGGCAAACAAATGGAGCTGGG - Intronic
1118325431 14:64777368-64777390 CCAGGGAAACAGATGCAGCTAGG + Intronic
1119558717 14:75572937-75572959 CCAGTGAAACAGCTGGAGCTCGG + Intergenic
1120011745 14:79423355-79423377 GTTGGGATAAAGATGGAGCTTGG - Intronic
1120215863 14:81679971-81679993 CTAGGGGACGAGTTGGAGATGGG + Intergenic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1120723032 14:87907729-87907751 TTAAGGAAGGAGATGGATCTGGG + Intronic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1121291676 14:92780658-92780680 CAAGGGAAGGAGAAAGAGCTAGG + Intergenic
1121737302 14:96227393-96227415 CAAGGTAAAGAGTGGGAGCTGGG + Intronic
1122987441 14:105219017-105219039 ATAGCGAAAGAGAAGGAGCTCGG - Exonic
1202943246 14_KI270726v1_random:3056-3078 TTAGGGAAAAAAATGGAGATGGG - Intergenic
1124115530 15:26839227-26839249 CAAGGAAGAGAGATGGGGCTTGG + Intronic
1124711087 15:32012491-32012513 CAAGGGCAAGGGATGGAGGTTGG - Intergenic
1125356975 15:38826672-38826694 CTAGGGAAGGAGGTGGAGGTAGG - Intergenic
1125720995 15:41845099-41845121 CCAGGGCAAGGGCTGGAGCTGGG + Intronic
1125795387 15:42400756-42400778 CTAGGGAAAGGAATTTAGCTTGG + Intronic
1126318638 15:47398032-47398054 CTAGGGAAAGTGTTGGGGGTTGG - Intronic
1126900221 15:53307257-53307279 CTATAGGAAGAAATGGAGCTTGG + Intergenic
1126936541 15:53715568-53715590 CTAGGGAAAGAGAGATCGCTTGG + Intronic
1127590772 15:60420424-60420446 CTAGAGAATGCGATGGAGCTGGG - Exonic
1127885668 15:63197869-63197891 GTAGGGAAAGAGAGGGAGGGCGG + Intronic
1127974200 15:63985160-63985182 CTAGGGAAAGAGAAGATCCTGGG + Intronic
1128566052 15:68700901-68700923 CAAAGGAAAGATGTGGAGCTCGG - Intronic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1129035452 15:72646110-72646132 ATAGGGAAAGAGTGGGACCTGGG + Intergenic
1129214432 15:74091106-74091128 ATAGGGAAAGAGTGGGACCTGGG - Intergenic
1129373139 15:75110367-75110389 GCAGGGAAGGTGATGGAGCTGGG - Intronic
1131066870 15:89440112-89440134 CTAGGCATAGAGATGCAGCTGGG - Intergenic
1131082754 15:89550647-89550669 GCAGGGACACAGATGGAGCTAGG + Intergenic
1132985409 16:2764157-2764179 CAAGGGAAAGAAGTGGTGCTGGG + Exonic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133395594 16:5444674-5444696 CAAGGGAAAAATATGGGGCTGGG + Intergenic
1134404806 16:13947146-13947168 ATGGGGAAAGGGAAGGAGCTGGG - Intronic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135818414 16:25657086-25657108 TTAGGGAAGAAGATGGAGCTTGG - Intergenic
1136412168 16:30083825-30083847 GTTGGGAAAGAGAGGGAGCAGGG + Intronic
1136483081 16:30555077-30555099 CTAGGGCAAGAGCTGGCCCTGGG - Exonic
1136569150 16:31086492-31086514 CTGGTGAAAGAGACGGGGCTGGG + Intronic
1137070288 16:35898965-35898987 CTATGGAAAGAGTTGAAGATCGG + Intergenic
1137933856 16:52614555-52614577 CTAGTGCAAGAGATGGAGAAGGG + Intergenic
1138189230 16:55000598-55000620 CAAGGGAGAGAAATGGAGATAGG - Intergenic
1139731325 16:68947942-68947964 GTTGGGAGAGTGATGGAGCTGGG + Intronic
1140315655 16:73894298-73894320 CTAGGGAAAGAGAGAGAGAATGG + Intergenic
1140656695 16:77148477-77148499 CTTGGGAAAGATGTGGAGCCAGG + Intergenic
1143711143 17:8736119-8736141 CTAGGGAAATAGCAGGAGTTAGG + Intronic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1148065922 17:44869732-44869754 CGAGGGAAAGAGATGGGGCTTGG - Intronic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1149306024 17:55347309-55347331 ATGGTGAAAGGGATGGAGCTTGG - Intergenic
1149630680 17:58119750-58119772 CTAGGGAGAGTGATGGAAATGGG + Intergenic
1149642154 17:58210008-58210030 CTAGGGAAAGTGAGGGATCAAGG + Intronic
1150302641 17:64059381-64059403 CCAGGGACAGAGATGCACCTGGG - Intronic
1151144995 17:72032180-72032202 CAAAGGGAAGAGATGGAACTGGG - Intergenic
1151375877 17:73688789-73688811 TTAGGGAAACAGATGGCCCTGGG + Intergenic
1151658153 17:75505160-75505182 GTAGGGAAAGAGCTGGACCAGGG - Intronic
1151706828 17:75773643-75773665 CCAGGGAAGGAGAGGGAGATGGG - Intergenic
1151879243 17:76885265-76885287 TGAGGGAGAAAGATGGAGCTGGG - Intronic
1152060695 17:78072439-78072461 CTAGAGAGAGACATGGAGATGGG + Intronic
1152698747 17:81808819-81808841 CTAGGGATAAAGAGGGAGCTGGG - Intronic
1153660278 18:7319917-7319939 CTACAGACAGCGATGGAGCTTGG - Intergenic
1154508467 18:15067468-15067490 ATAGAGTCAGAGATGGAGCTGGG + Intergenic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1156576718 18:38325502-38325524 TTAGAGAAAGAGAGTGAGCTTGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159090814 18:63846637-63846659 CTAAGGTAAGAGATGGAATTTGG - Intergenic
1159256110 18:65948337-65948359 CTAGGGAAAATGATGTATCTTGG - Intergenic
1159653583 18:71005399-71005421 TTAAGGAAAGGGATGGAGATTGG - Intergenic
1160749199 19:726047-726069 CTAGGGGAAGAGGCAGAGCTGGG + Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161152451 19:2716846-2716868 CCAGGGAAAGAGATGGAAACGGG + Exonic
1161222744 19:3125468-3125490 CTAGGAAGAGAAATGGAGCAGGG + Intergenic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162914453 19:13866346-13866368 GTAGGGAAAGAGATGGGGGGAGG - Intronic
1163828065 19:19534934-19534956 GTAGGGGAAGGGATGGGGCTTGG - Intronic
1164110740 19:22155800-22155822 GTAGGGAAATGGATGAAGCTGGG - Intergenic
1165059508 19:33198219-33198241 CTAGGGCCAGTCATGGAGCTTGG + Intronic
1165870772 19:38971466-38971488 CTAGGGATAGATTTGGAACTTGG - Intronic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166863935 19:45825096-45825118 GTTGGGGAAGAGCTGGAGCTGGG + Intronic
1167676260 19:50887929-50887951 CTGGGCTAAGAGAGGGAGCTGGG + Intergenic
1168327096 19:55544041-55544063 CTTGGGACAGAGTTGGACCTGGG + Intronic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925082050 2:1078298-1078320 CTAGGGAGAAAGATAAAGCTGGG + Intronic
925393543 2:3516184-3516206 CTTGTAAGAGAGATGGAGCTGGG + Intronic
925721750 2:6836049-6836071 ATAGGGAAGGGAATGGAGCTTGG - Intergenic
929277697 2:40043560-40043582 AAAGGGAGAGTGATGGAGCTGGG + Intergenic
929824999 2:45303132-45303154 ATGGGGAGAGAGAGGGAGCTGGG + Intergenic
930087146 2:47505736-47505758 CTGGGGAGAGAGATGAAGCCGGG + Intronic
930489407 2:52049363-52049385 GTTGGTAAAGAGATAGAGCTGGG + Intergenic
930831205 2:55745187-55745209 CTGGAGAAAGAAAAGGAGCTTGG - Intergenic
931619939 2:64199788-64199810 CTTGGGAAAGAGATGAAAATAGG + Intergenic
932080393 2:68709249-68709271 GTAGGGAAAGAAATGGAGAACGG - Intronic
932387988 2:71356091-71356113 CTATGGGAAGAGGTGGAGATAGG - Intronic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933943205 2:87262291-87262313 CAAGGGAAAGCAATGGAGATTGG + Intergenic
934652557 2:96100756-96100778 TGAGGGACAGTGATGGAGCTTGG + Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
936337007 2:111599272-111599294 CAAGGGAAAGCAATGGAGATTGG - Intergenic
936522847 2:113222435-113222457 CTGGGGCAGGGGATGGAGCTCGG + Intronic
937029184 2:118723965-118723987 ATATGGAAAGGGATGGAGCTGGG + Intergenic
937328280 2:121005316-121005338 GTAGGTAAAGAGATGGGGCTGGG - Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
939954672 2:148517599-148517621 CCAGGGTGAGAGATGGAGGTGGG + Intronic
940680554 2:156779953-156779975 CCAGGGAAAGAGATAGAGGTAGG + Intergenic
941020774 2:160406750-160406772 CTGGGAAAAGGAATGGAGCTGGG - Intronic
941435447 2:165465400-165465422 CTAAGGAAATAGATGAGGCTTGG - Intergenic
942299335 2:174547017-174547039 CTAGAGAAAGAGATGGGCCTGGG + Intergenic
942770684 2:179514717-179514739 ATAGGGAATGACATGGAGGTTGG + Intronic
942846935 2:180438092-180438114 CTAAGGAAAGAAAAGGAGGTAGG + Intergenic
945444039 2:209914583-209914605 CTGGGGAAAGGAATGGTGCTGGG - Intronic
946024097 2:216661502-216661524 TTATGGAAAGAAGTGGAGCTTGG + Intronic
946180748 2:217947511-217947533 AGGAGGAAAGAGATGGAGCTGGG + Intronic
946500271 2:220239901-220239923 CTAGGGACATGTATGGAGCTAGG - Intergenic
946698428 2:222385277-222385299 CTAGGAAAGGAGAAGGGGCTTGG - Intergenic
947317876 2:228881574-228881596 CTAGGGAAACTGATGGGACTTGG + Intronic
947907325 2:233775033-233775055 CTAGGGAAGGAGATGGAGCTGGG - Intergenic
1169078846 20:2782065-2782087 CAAGGGAAAGAAGTGGAGATGGG + Intergenic
1169926490 20:10789886-10789908 CTGGGGAAAGACTTGGAGTTAGG + Intergenic
1170157349 20:13280646-13280668 CCAGGGAAAGAAAGGGAGCCTGG + Intronic
1170280917 20:14647920-14647942 CTGGGGAAAGAGGTGGTGTTGGG - Intronic
1170645158 20:18191230-18191252 CCAGGCAAAGAGAAGGGGCTGGG - Intergenic
1170818940 20:19739646-19739668 CTTTGGAAGGAGCTGGAGCTGGG + Intergenic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1172579679 20:36037024-36037046 CTCAGGAAAGGGATGGAGCCTGG - Intergenic
1173023260 20:39285316-39285338 CTTGGGAAAGAGTTGGGGCATGG + Intergenic
1173155776 20:40607357-40607379 AGAGGGAAAGAAAGGGAGCTAGG - Intergenic
1175139863 20:56852931-56852953 CTAGGGAAAGAGTTGTGGATGGG + Intergenic
1175280191 20:57798760-57798782 CTATGGTAAGGGATGGGGCTGGG + Intergenic
1175533742 20:59692713-59692735 CTATGGAAAGAGTTGGAACCAGG + Intronic
1175656172 20:60772906-60772928 CCAGCTAAAGAGATGGAGCAGGG + Intergenic
1175664897 20:60850170-60850192 CTAGGGTAGGCGATGTAGCTTGG - Intergenic
1175754877 20:61523130-61523152 CTAGGGAGAGGGATGGAGGATGG - Intronic
1176167207 20:63680545-63680567 ATTGGGCAGGAGATGGAGCTTGG + Intronic
1176695205 21:9968864-9968886 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1176890777 21:14316028-14316050 CTAGGAAACGAGATGGGGCTAGG + Intergenic
1178580580 21:33834795-33834817 GTAGGTCATGAGATGGAGCTGGG + Intronic
1178631726 21:34267272-34267294 CTCGGGAAAGGGAGGTAGCTGGG - Intergenic
1178786812 21:35661312-35661334 TTGGAGAAAGAGAGGGAGCTGGG + Intronic
1179318459 21:40268171-40268193 CTTGAGAAAGACATGGAGATGGG - Intronic
1181791872 22:25274226-25274248 CAAGGGAGGGAGTTGGAGCTGGG - Intergenic
1181827504 22:25530037-25530059 CAAGGGAGGGAGTTGGAGCTGGG - Intergenic
1181893304 22:26083975-26083997 CTAGGGACAGAGATGGAGGCAGG + Intergenic
1183093071 22:35536618-35536640 GTAGACAAAGAGATGGGGCTGGG - Intergenic
1183321681 22:37168820-37168842 GGAGGGAAGGAGATGGAGCTGGG - Intronic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
949210716 3:1497125-1497147 CTAGGGAAAGAAATGTTGCCTGG - Intergenic
949711362 3:6874616-6874638 TTAGTGAGAGAGACGGAGCTAGG + Intronic
950271184 3:11616427-11616449 CTAGGGAATGAGCTGGGTCTAGG - Intronic
950341616 3:12251126-12251148 CTAGGGGGAGAGAGGGAGCTAGG + Intergenic
950626675 3:14252609-14252631 CTAGGGAAAGAGACAGAGAGAGG + Intergenic
950712359 3:14821352-14821374 CTGGGGAAGGAGATGGACCGTGG - Exonic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
950974625 3:17227545-17227567 GTAGGAACATAGATGGAGCTGGG + Intronic
951619848 3:24588804-24588826 GTAGGGAAAGAGAGGGTGGTGGG - Intergenic
952280204 3:31915609-31915631 GTAGGGAAGGAGAGGGAGCAAGG + Intronic
952511179 3:34057669-34057691 ATAAAGAAAGAAATGGAGCTAGG - Intergenic
952917025 3:38254402-38254424 GTTGGGAAAGAGATGGATGTTGG + Exonic
954143216 3:48621084-48621106 CAAGGGGCAGTGATGGAGCTGGG + Intronic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
956532793 3:70239307-70239329 CTAGGGTAAGACTTGGACCTTGG - Intergenic
956787156 3:72652262-72652284 CTAGGGAACTAGACTGAGCTAGG - Intergenic
959256701 3:104024370-104024392 GCAGGGACACAGATGGAGCTGGG + Intergenic
959569367 3:107866894-107866916 CTAGGAAAAGAGTTGGAGACTGG - Intergenic
959681912 3:109105883-109105905 CTAGGTAGAGAGAAGGAACTGGG - Intronic
961195828 3:125000640-125000662 CTGGGATAAGAGCTGGAGCTTGG - Intronic
961523752 3:127483637-127483659 CTAAGGAGAAAAATGGAGCTGGG - Intergenic
961733282 3:128983683-128983705 TTGGGGAAAGAGATGAGGCTGGG + Intronic
961925872 3:130479489-130479511 CTATGGAAAGAGCTGTATCTTGG + Intronic
964055590 3:152452394-152452416 GTCAGGAAAGAGAGGGAGCTGGG - Intronic
964090391 3:152869244-152869266 TTAGGGAAAGAGAAGGAACTAGG - Intergenic
965184249 3:165443146-165443168 CTAGGGAAAATGATGGATCTGGG + Intergenic
965330082 3:167362076-167362098 TTAGGGAAAGGGTTGGAGGTAGG + Intronic
965960192 3:174420117-174420139 TAAGGGAAAGAGATGAAGATGGG - Intergenic
966429956 3:179820876-179820898 GTAGGGAAAGAGATGGAGGGTGG + Intronic
967427775 3:189347235-189347257 CTAGGTAAAAATATGGAGTTGGG + Intergenic
967876730 3:194272647-194272669 CTAGGAAAGTAAATGGAGCTTGG + Intergenic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
969917207 4:10502400-10502422 CTAGGGAGAGACCTGGATCTTGG - Intronic
970948569 4:21725250-21725272 CTAAGAAAAGAAAGGGAGCTGGG - Intronic
971072095 4:23105725-23105747 CAAGAGAATGAGATAGAGCTGGG + Intergenic
971453550 4:26822477-26822499 TTAGGGAAACATATGGGGCTTGG - Intergenic
973871558 4:55171571-55171593 CTAAGGAAAGAAATGGGGGTCGG + Intergenic
974297966 4:60028094-60028116 CTAGTGATGGAGATGGGGCTTGG - Intergenic
974878543 4:67725962-67725984 CTAAGGAAAGCTAAGGAGCTGGG + Intergenic
977569443 4:98614342-98614364 CCAGGCAAGGGGATGGAGCTGGG - Intronic
978542351 4:109831616-109831638 ATAGGAAAAGAGAAGGAGCAGGG + Intronic
980367832 4:131829073-131829095 TTGGGGAAAGAGAAGGAGATTGG - Intergenic
980367836 4:131829092-131829114 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
980409520 4:132398613-132398635 CTCGGGAAAGAGTGGGAGATGGG - Intergenic
982570743 4:157048241-157048263 CCATGGAGAGATATGGAGCTGGG - Intergenic
984214930 4:176899341-176899363 CTTGTGAAATAGATGGAGCTAGG + Intergenic
984258131 4:177411398-177411420 AAGGGGAAAGAGATGGACCTGGG - Intergenic
985539101 5:479560-479582 CTGGGGAAAGCAAGGGAGCTCGG + Intronic
986395075 5:7321424-7321446 ACATGGTAAGAGATGGAGCTTGG + Intergenic
987861964 5:23500471-23500493 AGAGGGAAAGAGTTGAAGCTTGG - Intergenic
988832941 5:35004848-35004870 TTGGGGAAAGAGTTGGATCTGGG - Intronic
989305982 5:39956354-39956376 GTAGGGAAAGAAAAGGAGGTAGG + Intergenic
989488304 5:42018879-42018901 CTAGGGAGAGAAATGCTGCTAGG + Intergenic
989774459 5:45186671-45186693 CTAGGGAAAGAGCTGGAAAATGG - Intergenic
990561436 5:56987478-56987500 CTAGGGCCTGGGATGGAGCTTGG - Intergenic
991126452 5:63075274-63075296 CAAGGGAAAGTGATGGATCCAGG - Intergenic
991372723 5:65936352-65936374 CTAGGAAAAGATAAGGATCTTGG + Intronic
992081020 5:73234294-73234316 GAAGGGAAAAAGATGGAGGTGGG - Intergenic
992275479 5:75113118-75113140 ATAGGGAAAGAGAAGGATCAGGG - Intronic
992948950 5:81837893-81837915 CAAGGGAAAGGGAGGGAGCTGGG + Intergenic
993149994 5:84149109-84149131 CTAGTGAAAGAGAGGGAGCTGGG + Intronic
996447457 5:123572205-123572227 CTAGGGAAGGAGATGAAGGGAGG - Intronic
999095972 5:148978584-148978606 CTATGGAAAGAGCTGGAGGGAGG - Intronic
999268324 5:150281399-150281421 CTGGGGGAAGAGAAAGAGCTGGG + Intronic
999558654 5:152774523-152774545 GTAGGGACATAGATGAAGCTGGG + Intergenic
999690287 5:154140546-154140568 CCAGAGGCAGAGATGGAGCTAGG - Intronic
1000631848 5:163599675-163599697 CAATGGAAAGAGATGGAGTATGG + Intergenic
1001554191 5:172625091-172625113 ATAGGGAAATGGAGGGAGCTGGG + Intergenic
1003079741 6:3012372-3012394 CTAGGGAAAGAGAAGCAGTCTGG - Intronic
1003720284 6:8693775-8693797 CTAGGTTAAGAGGTGGAGCCAGG - Intergenic
1004294844 6:14401211-14401233 CTAGGGAAAGAGAAAGAGTAGGG - Intergenic
1004373819 6:15075057-15075079 CAAGGGAAAGGCATGGAGCAGGG - Intergenic
1004428639 6:15523788-15523810 CCTGGGGAAGAGAAGGAGCTTGG - Intronic
1004512589 6:16294913-16294935 CTACAGAAAGTGCTGGAGCTGGG + Intronic
1005436117 6:25813879-25813901 GCAGGGAAATGGATGGAGCTGGG - Intronic
1006282667 6:33067853-33067875 CAAGGGAGAGAGAGAGAGCTCGG + Intronic
1006609807 6:35287589-35287611 CAAGGGGAAGAGATACAGCTGGG - Intronic
1007381671 6:41494200-41494222 CTAGGGGTGGATATGGAGCTTGG - Intergenic
1007603555 6:43099563-43099585 CTAGGGATATAGATAGAGCAGGG + Intronic
1008402997 6:51085794-51085816 CTAGGGAATGAGATGGCAATGGG - Intergenic
1008635511 6:53406706-53406728 ATACGGAAAGAGATGGATTTTGG - Intergenic
1008843982 6:55939445-55939467 GCAGGGACATAGATGGAGCTGGG + Intergenic
1010305246 6:74313153-74313175 CTAGGGAAAGGTTTTGAGCTAGG - Intergenic
1011309230 6:85963818-85963840 CCAGGAAAAGAGAAGGGGCTAGG - Intergenic
1011732734 6:90282449-90282471 GCAGGGACATAGATGGAGCTGGG - Intronic
1012517171 6:100075795-100075817 CTAGAGAAAGAGAAGGAACTGGG + Intergenic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1013287054 6:108690822-108690844 ATAGGGAAAGAAATGGAGAAAGG + Intergenic
1014892660 6:126861812-126861834 GTAGGGACATAGATGAAGCTGGG - Intergenic
1015367333 6:132411108-132411130 CTAGGGAAATAGATCGATCCAGG - Intergenic
1017456665 6:154606946-154606968 GCAAGGAAGGAGATGGAGCTGGG - Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018596512 6:165486948-165486970 ATTGTGAAAGAGATGGAGCCAGG + Intronic
1018950177 6:168373984-168374006 CCAGGGAAGGAGAAGGAGCTGGG + Intergenic
1019364298 7:623922-623944 CTAGGGAAGGAGGTGGAGGATGG + Intronic
1019377208 7:699178-699200 CCAGGGAGAGTCATGGAGCTGGG - Intronic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1020437990 7:8186387-8186409 CTAGGGAAGGAGAGTGGGCTGGG + Intronic
1020777596 7:12474026-12474048 CAAGGAAAAGAGATGGAGTCAGG + Intergenic
1021667430 7:22998925-22998947 ATAGGCAAAGACATGGAGCCTGG - Intronic
1021773930 7:24032973-24032995 GTAGGAACATAGATGGAGCTGGG - Intergenic
1022847134 7:34221620-34221642 CTAGGCATAGAGTTGGAGGTGGG + Intergenic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023741715 7:43287189-43287211 ATAGGGAAAGAGAGTGAGCATGG + Intronic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024520427 7:50301210-50301232 CTATGGAAAGAGAGGCAGCTAGG - Intergenic
1026293354 7:69028765-69028787 ATAGGCATTGAGATGGAGCTGGG - Intergenic
1026361451 7:69604599-69604621 ATGGGGAAGGAGTTGGAGCTAGG + Intronic
1026552893 7:71382758-71382780 CTAGAGAAAGAGAAGGAATTGGG + Intronic
1026941221 7:74289226-74289248 GAAGGGAAGGAGATGGAGCGGGG + Intergenic
1026991867 7:74590744-74590766 CTAGGGAAAGGGCTGGAGTCTGG - Intronic
1027353402 7:77334270-77334292 GCAGGGACACAGATGGAGCTGGG + Intronic
1028348951 7:89819534-89819556 CTATTGGGAGAGATGGAGCTGGG - Intergenic
1029022174 7:97376313-97376335 GCAGGGACACAGATGGAGCTGGG + Intergenic
1029483587 7:100826760-100826782 TTTGGGAAAGAGATGGAGTCTGG - Intronic
1030128520 7:106177821-106177843 CAAGGGAAAGAGACAGAGCAGGG - Intergenic
1031411738 7:121447761-121447783 GCAGGGAAGGAGATGGAGATGGG - Intergenic
1032698090 7:134355124-134355146 CTCGGGAGAGCCATGGAGCTAGG + Intergenic
1033260362 7:139838829-139838851 CCAGGGCTGGAGATGGAGCTGGG + Intronic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1034707505 7:153158663-153158685 CTAGGGACAGAGATGGGGGTTGG + Intergenic
1036403079 8:8427757-8427779 CTAGAGAATTAGTTGGAGCTAGG - Intergenic
1036629028 8:10497287-10497309 GCAGGGAAAAGGATGGAGCTTGG + Intergenic
1037590617 8:20309088-20309110 CTATTGAAAAAGATGGAGCGAGG - Intergenic
1038061017 8:23912832-23912854 CTAGGCAAAGAAATGGACATGGG - Intergenic
1039244029 8:35588265-35588287 CTTAGGAAAGAGAGGTAGCTAGG + Intronic
1039434269 8:37548830-37548852 CTAGGGATAGATATGGAACCAGG + Intergenic
1043784857 8:84386044-84386066 CTTGGGAAAGAGAGGCATCTTGG + Intronic
1044513874 8:93116096-93116118 TCAGTTAAAGAGATGGAGCTGGG - Intergenic
1045576548 8:103427786-103427808 CTAAGGGAAGAGTTGGAGATTGG + Intronic
1047574164 8:126134727-126134749 CTAGGGATAGAATTGGAGTTTGG - Intergenic
1049273565 8:141708650-141708672 CTTGGGAAGGAGTTGGACCTGGG + Intergenic
1050449034 9:5760224-5760246 TTAGGGTAAGAGATTGAGTTTGG + Intronic
1051207149 9:14700050-14700072 CTAGGGGGAGAAATAGAGCTGGG - Intergenic
1051262336 9:15276723-15276745 CTAGGGTCAGAGGTGGAGCCAGG - Intronic
1052850756 9:33377080-33377102 CTAGGGAAAGCCAGGGATCTGGG - Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1053632183 9:39954811-39954833 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1053773582 9:41508724-41508746 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054211705 9:62295887-62295909 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054313277 9:63552942-63552964 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1055067584 9:72134094-72134116 GTAGGGAAAGGGAAGGGGCTTGG + Intronic
1055122159 9:72673802-72673824 CTAGGGAAACAGTCAGAGCTTGG - Intronic
1056465186 9:86846800-86846822 CTAGGGGAAGAGAGACAGCTAGG + Intergenic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1059395378 9:114031231-114031253 CTAGGGAAAGGGGTGGGGGTGGG - Intronic
1059432634 9:114259218-114259240 CGAGGGAGAGGGATGGGGCTGGG + Intronic
1060032318 9:120225704-120225726 ACAGGGAAAGAGAGGGAACTTGG - Intergenic
1060552480 9:124492242-124492264 GTAGGGAAAGAGAGGGAGGGGGG - Intronic
1062633337 9:137477216-137477238 CTTGGAACAGAGATGGAGCCTGG - Intronic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1185666237 X:1767507-1767529 CCATGGAAAGAGTTGGAGCAGGG - Intergenic
1186232003 X:7465422-7465444 CTAGGGAAGGAGAAAGAGTTGGG + Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187882104 X:23856936-23856958 GCAGGGACAGGGATGGAGCTGGG + Intronic
1188487815 X:30702625-30702647 CTAAGGAATGACATGGATCTGGG - Intronic
1190334208 X:49252712-49252734 CCAGGGAAGGAGATGGGGTTGGG + Intronic
1190550046 X:51570609-51570631 CTGGGGGAGGAGATGGAGTTTGG + Intergenic
1191214092 X:57917974-57917996 CTAGGGACAGGGATGGGGATGGG - Intergenic
1192261701 X:69509423-69509445 CTAGGGGGAGTGATGGAGATGGG + Intronic
1194077222 X:89411154-89411176 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1194820231 X:98496795-98496817 ATAGGGAATGAGGGGGAGCTTGG - Intergenic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1197747873 X:129944952-129944974 CTCTGGAGTGAGATGGAGCTAGG + Intergenic
1199506365 X:148566256-148566278 ATAGGGAAAGAGAATGAGCTTGG - Intronic
1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG + Intergenic
1199880812 X:151973312-151973334 CTAGGGCAAAAGATGGCTCTGGG - Intronic
1199966544 X:152825086-152825108 ATGGGGAAGGAGAGGGAGCTGGG - Intergenic
1200429868 Y:3066699-3066721 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1201327499 Y:12779541-12779563 CAAAGGAAAGAGATGTATCTGGG - Exonic
1201359380 Y:13129863-13129885 CTAGGGAAAGAGGTGGAACTAGG - Intergenic
1202118280 Y:21496329-21496351 ATAGGGAAAAAAATGTAGCTAGG - Intergenic
1202120732 Y:21519869-21519891 ATAGGGAAAAAAATGTAGCTAGG - Intronic
1202123183 Y:21543410-21543432 ATAGGGAAAAAAATGTAGCTAGG - Intronic
1202155823 Y:21885971-21885993 ATAGGGAAAAAAATGTAGCTAGG + Intronic
1202158271 Y:21909512-21909534 ATAGGGAAAAAAATGTAGCTAGG + Intronic
1202184725 Y:22174437-22174459 ATAGGGAAAAAAATGTAGCTAGG + Intronic
1202206635 Y:22411964-22411986 ATAGGGAAAAAAATGTAGCTAGG - Intronic