ID: 1097102522

View in Genome Browser
Species Human (GRCh38)
Location 12:56599726-56599748
Sequence AGGCTGTCCCAGAAGGAGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097102522_1097102529 6 Left 1097102522 12:56599726-56599748 CCAATCTCCTTCTGGGACAGCCT 0: 1
1: 0
2: 6
3: 15
4: 287
Right 1097102529 12:56599755-56599777 TGGGACGATGGCAGTAAATGTGG 0: 1
1: 0
2: 0
3: 16
4: 119
1097102522_1097102526 -6 Left 1097102522 12:56599726-56599748 CCAATCTCCTTCTGGGACAGCCT 0: 1
1: 0
2: 6
3: 15
4: 287
Right 1097102526 12:56599743-56599765 CAGCCTCCATCTTGGGACGATGG 0: 1
1: 0
2: 0
3: 6
4: 105
1097102522_1097102530 15 Left 1097102522 12:56599726-56599748 CCAATCTCCTTCTGGGACAGCCT 0: 1
1: 0
2: 6
3: 15
4: 287
Right 1097102530 12:56599764-56599786 GGCAGTAAATGTGGCAGCCACGG 0: 1
1: 0
2: 1
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097102522 Original CRISPR AGGCTGTCCCAGAAGGAGAT TGG (reversed) Exonic
900548677 1:3242647-3242669 AGGGTGACCCGGAAGGCGATGGG + Intronic
901850517 1:12012026-12012048 AGTCTGTCCCAGAAGGACTGTGG + Exonic
902091950 1:13910610-13910632 AGGCTTCCCCAGAAGCAGAGCGG + Intergenic
902966761 1:20010618-20010640 TAGCTGTCCCATAAGGAGGTTGG + Intergenic
903257369 1:22111876-22111898 CTGCTGTCCAAGAAGGGGATGGG + Intergenic
903883091 1:26525432-26525454 AGGCTGAGGCAGAAGGAGAATGG + Intergenic
904285886 1:29453035-29453057 AGGCAGTGCCAGCAGGAGCTGGG + Intergenic
904771041 1:32881550-32881572 AGGCTGTGGGAGAAGGTGATGGG + Intergenic
905017982 1:34790766-34790788 GGGCTTACCCAGAAGGTGATAGG + Intronic
906740858 1:48182480-48182502 AGGATGTGCCAGAGTGAGATGGG + Intergenic
906855329 1:49298250-49298272 ATGCTGGCCCAGGAGGAGAATGG + Intronic
907423279 1:54361949-54361971 AAGCTCTCCCAGAAAGAGACTGG + Intronic
907864898 1:58390165-58390187 AGTCTGCCTCAGAAGGAGCTGGG - Intronic
909244897 1:73269151-73269173 AGGTGGTCTCAGATGGAGATGGG + Intergenic
910855071 1:91686820-91686842 AGGCTGCTCCTAAAGGAGATGGG + Intronic
912405592 1:109434965-109434987 AGGTGGTCTCAGATGGAGATGGG - Intergenic
913334480 1:117696460-117696482 AGGCTGTTCCAGATTGAGAGTGG - Intergenic
915611717 1:156999028-156999050 AGGCTGCCCCAGCAGGAGGGAGG + Intronic
916735958 1:167607256-167607278 AGGAGGTCTCAGATGGAGATGGG + Intergenic
918232662 1:182550375-182550397 AGACTGTCCCTCAAGGAGAGGGG + Intronic
919308860 1:195879146-195879168 AGATGGTCCCAGATGGAGATGGG - Intergenic
919474448 1:198017210-198017232 AGGGTGTTTCTGAAGGAGATCGG - Intergenic
919720325 1:200826551-200826573 AGGCCGTTCCAGGAGGATATTGG - Intronic
920962193 1:210673250-210673272 AGGCTGACCAAGAAGGACAGAGG + Intronic
922320267 1:224480725-224480747 AGGTGGTCTCAGATGGAGATGGG - Intronic
923777646 1:236994480-236994502 TGTCTATCCCAGCAGGAGATGGG - Intergenic
923932757 1:238721483-238721505 AGGTGGTCTCAGATGGAGATGGG + Intergenic
924428693 1:243977881-243977903 AAGATGTCCAATAAGGAGATGGG + Intergenic
924817990 1:247459738-247459760 AATATGTCCCAGAAGAAGATGGG + Intergenic
1062836072 10:636675-636697 AGGCTGTCCCTGACGAAGATGGG - Intronic
1067430149 10:46237412-46237434 TGCCACTCCCAGAAGGAGATGGG + Intergenic
1067546164 10:47194092-47194114 AGGCTGTCCCAGAATCAAGTGGG - Intergenic
1067712720 10:48662786-48662808 AGCCAGTCCCAAAAGGACATAGG + Intergenic
1068487480 10:57678406-57678428 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1069102199 10:64335779-64335801 ACCCTCTCACAGAAGGAGATTGG - Intergenic
1069367706 10:67711423-67711445 AGGTGGTCTCAGATGGAGATAGG + Intergenic
1070635213 10:78120127-78120149 AGGATGTACCAGAGGGAAATGGG + Intergenic
1071843047 10:89492895-89492917 AGGCCTCCCCAGGAGGAGATAGG - Intronic
1072802793 10:98405038-98405060 AGGCTGGCCCAGGGGGAGATGGG + Intronic
1073922203 10:108471574-108471596 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1075440363 10:122475309-122475331 AGACTGTCCCGGAAAGAGAGGGG + Intronic
1076774170 10:132685113-132685135 ATGCTGTCTCAGAGTGAGATGGG + Intronic
1076924135 10:133473225-133473247 AGGCTGTACAGGAAGGAGAGTGG - Intergenic
1077089795 11:773227-773249 AGGCTTTCCCAGAAGGAATCAGG + Intronic
1079694100 11:23457049-23457071 AGGCAGTTACAGAAGGAGAGGGG + Intergenic
1079974415 11:27074493-27074515 AGGTAGTCTCAGATGGAGATGGG + Intronic
1080231850 11:30025388-30025410 AGGCTTTCCCAAAAGGAGCCCGG + Intergenic
1080344648 11:31310982-31311004 AGGTAGACACAGAAGGAGATAGG - Intronic
1080655243 11:34253018-34253040 AGCCTTTCCCAGGTGGAGATGGG - Intronic
1081276429 11:41155205-41155227 AGGATGTCCCATAAGGATGTTGG - Intronic
1081493584 11:43584506-43584528 CTGCTGTCTCAGAAGGAGAATGG - Intronic
1082026859 11:47578862-47578884 AGGCTCTGCCACAAGGAGCTAGG + Intronic
1083949347 11:65945526-65945548 ACTCTCTCCCAGAAGGAGATTGG + Exonic
1084631725 11:70356466-70356488 AAGCTGTCCAACCAGGAGATAGG + Intronic
1088841170 11:113628802-113628824 AGCCAGTCCCTGAAGGAGGTAGG - Intergenic
1089231578 11:116982144-116982166 AGACTGTCCCAGATGGAACTGGG - Intronic
1090226270 11:125073952-125073974 AGGCTATCTCTGAAGGTGATGGG - Intronic
1090258285 11:125301186-125301208 AGGCAGTCCCAGCAGTGGATTGG - Intronic
1090415817 11:126539735-126539757 ATGCTGTCCCAGATGTAGTTGGG + Intronic
1090748968 11:129729459-129729481 AGACTGTGGGAGAAGGAGATGGG - Intergenic
1094357807 12:29596930-29596952 AGACTGTCCCAGAGGGTGAGTGG - Intronic
1095219175 12:39588182-39588204 AGACTGTTCCAGATGTAGATAGG - Intronic
1095308105 12:40662022-40662044 AGGTGGTCTCAGATGGAGATAGG + Intergenic
1095508585 12:42924885-42924907 ATACTGTACCAGAAGGAGAAAGG + Intergenic
1097102522 12:56599726-56599748 AGGCTGTCCCAGAAGGAGATTGG - Exonic
1097789353 12:63797783-63797805 AGGCAGACCAAGTAGGAGATTGG + Intronic
1098836280 12:75428197-75428219 AGGTGGTCTCAGATGGAGATGGG + Intronic
1099933741 12:89101695-89101717 AGGCTATCTCAGAGGAAGATCGG + Intergenic
1101877102 12:108603284-108603306 TGGCTGCCCCAGGAGCAGATGGG - Intergenic
1102527206 12:113520484-113520506 AGGCAGCCCCAGAAGGAACTCGG - Intergenic
1102563404 12:113778885-113778907 ATCCCGTCCCAGGAGGAGATGGG - Intergenic
1102763983 12:115415132-115415154 AGGCTGTGTCAGAATGAGAATGG - Intergenic
1104483622 12:129130258-129130280 GGGCATCCCCAGAAGGAGATGGG - Intronic
1106877242 13:34087621-34087643 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1106932463 13:34681797-34681819 AGGCTGTTACAAAAGGAGAAGGG - Intergenic
1106942710 13:34795412-34795434 AGGTGGTCTCAGACGGAGATGGG + Intergenic
1107067804 13:36234381-36234403 TGAGTGTCCCAGAAGGAGAGGGG + Intronic
1110164957 13:72430688-72430710 AGGCAGTCACAGAAGGACCTGGG - Intergenic
1110190775 13:72727195-72727217 ACGCTGTCACCGCAGGAGATCGG + Intronic
1110541743 13:76713812-76713834 AGGGTGTTTCTGAAGGAGATTGG + Intergenic
1112281539 13:98066888-98066910 AGGCTCTGCCAGAAGGAAAGAGG - Intergenic
1112744122 13:102508104-102508126 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1113133178 13:107060690-107060712 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1114134883 14:19835994-19836016 TTGGTGTCCCTGAAGGAGATGGG + Intergenic
1114585226 14:23805676-23805698 AGATAGTCCCAGAACGAGATGGG + Intergenic
1114689006 14:24563122-24563144 AGGCTTCCCCAGAAGTTGATGGG - Intergenic
1115130453 14:30047408-30047430 AGGTGGTCTCAGATGGAGATGGG - Intronic
1115581625 14:34764913-34764935 AGACTGTGCCTGAAGGAGACTGG - Exonic
1118587049 14:67363662-67363684 AAGTTGTACCACAAGGAGATAGG + Intronic
1119263398 14:73251220-73251242 AGGCGGTGGCAGCAGGAGATGGG - Intronic
1119305974 14:73608442-73608464 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1121177895 14:91904878-91904900 AAGCTGTCCCAGGAGGAAAGAGG - Intronic
1121471088 14:94154996-94155018 AGGTGGTCTCAGATGGAGATAGG + Intronic
1121570442 14:94942943-94942965 AGGCTGTCCTGGAAGGAGGGAGG - Intergenic
1123577941 15:21691559-21691581 CTGGTGTCCCTGAAGGAGATGGG + Intergenic
1123614566 15:22134041-22134063 CTGGTGTCCCTGAAGGAGATGGG + Intergenic
1124239903 15:28020220-28020242 AGGCTGCTCGAGAAGGAGCTCGG + Intronic
1124827710 15:33115238-33115260 AGGCTGTCCTATAAGGAGGGTGG + Intronic
1126266256 15:46756909-46756931 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1129637459 15:77335931-77335953 AAGATTTCCCAGAAAGAGATAGG - Intronic
1130235444 15:82128796-82128818 ATGCTGTCACAGAAGGGGACAGG + Intergenic
1131288793 15:91086804-91086826 AGGGGGATCCAGAAGGAGATGGG - Intergenic
1202986811 15_KI270727v1_random:425804-425826 CTGGTGTCCCTGAAGGAGATGGG + Intergenic
1135502387 16:23007963-23007985 AGACTATCACAGAAGGAGAGTGG + Intergenic
1135755032 16:25090103-25090125 AGGGCGGCCCAGAAGGAGCTCGG + Intergenic
1136419314 16:30122456-30122478 GGGCTGTCCCAGAGGGATAGAGG + Intronic
1137882696 16:52068840-52068862 TTGCTGGCCGAGAAGGAGATAGG + Intronic
1138345053 16:56315616-56315638 AGGCTGTCCCAGAGGGGCAGTGG + Intronic
1139296842 16:65908683-65908705 AGGCTGACCCAGAGGGTGAGCGG + Intergenic
1141193615 16:81842853-81842875 AGGCTGTGCCAGAAGGTGATGGG + Intronic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1142113166 16:88342684-88342706 AGGCTGTGCCAGCAGGCGGTGGG + Intergenic
1142642676 17:1293737-1293759 ACGCTGTCCCAGACGGAGCTTGG + Intronic
1147400237 17:40176660-40176682 ATGCTGCCCCAGAAGGAGTGTGG - Intergenic
1148219234 17:45850324-45850346 TGGCTGGGCCAGGAGGAGATGGG + Intergenic
1150280977 17:63929522-63929544 AGCCTGGCCCAGCAGGGGATGGG - Intronic
1150687307 17:67331086-67331108 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1151314300 17:73312192-73312214 AGGCTGCCCCATACGGAGTTGGG - Intergenic
1152196097 17:78919313-78919335 AGGGGGACCCACAAGGAGATTGG - Intronic
1153653743 18:7263897-7263919 TGGCTGTCCCAGGAAGAGCTGGG - Intergenic
1156207980 18:34906662-34906684 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1156277971 18:35603117-35603139 TGCCTGTCCCAGATGGAGGTGGG + Intronic
1156458539 18:37308242-37308264 AGGCAGTTCCAGAAGATGATGGG - Intronic
1159365196 18:67456308-67456330 AGTCTGTCTCAGAATGAGACAGG - Intergenic
1160231566 18:77053098-77053120 TGGCTGTCCCAGAAGCAGAGAGG + Intronic
1160554088 18:79714923-79714945 AGGCTGCCCCAGAGGGAGCCGGG + Exonic
1162788509 19:13051170-13051192 AGGCTGTCCCACCAGGTGTTTGG + Intronic
1163156747 19:15443884-15443906 AGGGGGTCCCAGGAGGGGATTGG - Intronic
1164411955 19:28013762-28013784 AGGCTGTACAAGAAGTAGAGTGG + Intergenic
1166130725 19:40744160-40744182 AGGCTGGCCCAGGAGGTGCTGGG - Exonic
1166215593 19:41332387-41332409 AGGGAGACCCAGATGGAGATAGG - Intronic
1166655274 19:44606608-44606630 AGGCTGTCAAGCAAGGAGATAGG - Intergenic
1167504200 19:49862701-49862723 ATGCTGTCCCCGATGGATATGGG + Exonic
1167695366 19:51012510-51012532 AGGCTGTGCCTGAAGGAGTCAGG - Intergenic
1167723474 19:51195162-51195184 CTGCTGTACCAAAAGGAGATAGG - Intergenic
1168255017 19:55160367-55160389 AGGCTGTCCAAGGGGGAGCTGGG + Intronic
925852050 2:8091235-8091257 AGGCTCTCACAGAAGGACATGGG - Intergenic
926806279 2:16714944-16714966 AGGATGTACCAGAAGGGGCTTGG - Intergenic
927540352 2:23904738-23904760 AGCCTGTCCTATAAGGAAATCGG - Intronic
929490919 2:42395398-42395420 AGGCTGTTTAAGAAGGAGTTGGG + Intronic
929601256 2:43206189-43206211 AGGCTGGCTGAGAAGGAGCTAGG + Intergenic
929950883 2:46408822-46408844 GGGCTGTCACAGAGGGTGATGGG + Intergenic
932185399 2:69691100-69691122 AGACTGTACCAGAAAGAGAAAGG - Intronic
933336240 2:80963315-80963337 TTGGTGTCCCTGAAGGAGATGGG - Intergenic
935456613 2:103276413-103276435 AGGCTGTCTCAGAAGAGGAAGGG + Intergenic
937608587 2:123832681-123832703 TGGAAGTCCCAGAAGGAGAGTGG - Intergenic
937893804 2:126962236-126962258 AGGCTGAACCTGAAGGAGATAGG - Intergenic
938965981 2:136388886-136388908 GGTCTTTGCCAGAAGGAGATTGG + Intergenic
939760505 2:146171535-146171557 AGGGTGTCAAGGAAGGAGATGGG + Intergenic
940277293 2:151952662-151952684 GGGCTGCCCCAGAAGGAAACAGG + Intronic
942283301 2:174389334-174389356 AGGTGGTCTCAGATGGAGATGGG + Intronic
943563929 2:189495558-189495580 AGGTGGTCTCAGATGGAGATGGG + Intergenic
944371275 2:198986218-198986240 AGGTGGTCTCAGATGGAGATTGG - Intergenic
946359123 2:219208435-219208457 GGGCTGTCCAGGACGGAGATCGG - Exonic
946368534 2:219266221-219266243 AGGCTGTGCCACCAGGAAATGGG + Intronic
947048826 2:226019300-226019322 AGGTGGTCTCAGATGGAGATGGG - Intergenic
947396603 2:229693587-229693609 AGGTGGTCTCAGAAGGAGATGGG + Intronic
947919480 2:233856798-233856820 TGGCTGGCTCAGAAGGAGTTTGG - Intergenic
948485734 2:238279677-238279699 AGGCTCTCCCAGAGCTAGATGGG - Intronic
948686539 2:239673955-239673977 AGCCTGTGTCAGAAGTAGATGGG - Intergenic
949066487 2:241993817-241993839 TGGCAGTTGCAGAAGGAGATGGG + Intergenic
1168785903 20:540070-540092 AGGGTGACTCAGACGGAGATAGG - Intronic
1169277723 20:4244708-4244730 AGGCTGTGCAGGAAGGAGAGGGG - Intronic
1170464212 20:16608173-16608195 AGGCTGTCCCAGAAAGAGACAGG - Intergenic
1172302157 20:33857874-33857896 AGGGTGTGCCAGGAGGAGGTGGG + Intergenic
1173690329 20:44955975-44955997 AGATTGTCTCAGAAGGAGAAAGG - Intronic
1176364478 21:6024437-6024459 AGGCTGTCCCAGAAGGAAGTTGG + Intergenic
1177198885 21:17931229-17931251 TGTCTGTCACAGAAGCAGATGGG - Intronic
1177604551 21:23360764-23360786 AGGCAGTCTCAGATGGAGATGGG - Intergenic
1179759040 21:43514108-43514130 AGGCTGTCCCAGAAGGAAGTTGG - Intergenic
1179917864 21:44489478-44489500 AGCCTTTCCTAGAAGGCGATTGG - Intergenic
1180028303 21:45181636-45181658 AGGTGTTCCCAGAAGGTGATCGG - Intronic
1180701161 22:17782107-17782129 AGGATTTCCCAGAGGGAGCTGGG + Intergenic
1181102398 22:20550182-20550204 AGCCTGTCCCTGAAGGACAGTGG - Intronic
1182030250 22:27153623-27153645 AGCCAGTCTCAGAAGGCGATGGG - Intergenic
1182182273 22:28362687-28362709 AGGTGGTCTCAGATGGAGATGGG + Intronic
1182440613 22:30361870-30361892 AGGCTGTCCAGGAAGGAGAAGGG - Intronic
1182549276 22:31092282-31092304 AGCCTGGCCCATTAGGAGATTGG + Intronic
1182828533 22:33285803-33285825 TGGCAGTCCCAGAAGGACACAGG + Intronic
1183080038 22:35450435-35450457 AGTCTGTCCCAGGAGGGGAGAGG - Intergenic
1185046034 22:48529208-48529230 AGGATGTCCAGGCAGGAGATGGG + Intronic
1185046158 22:48529640-48529662 AGGGTGTCCAGGCAGGAGATGGG + Intronic
1185215126 22:49594374-49594396 AGGCTGGCCCTGAGGGAGCTGGG - Intronic
1185331681 22:50254853-50254875 AGGCTGGCACAGAAGGAGCCGGG - Intronic
949109039 3:236382-236404 AGGCTGACCTAGAAGGACCTGGG - Intronic
950664299 3:14485944-14485966 AGGCTCTCCCGGCAGGAGCTGGG + Exonic
950808444 3:15628509-15628531 AGGTAGTCCAAGAAGGAAATGGG + Intronic
952401518 3:32967933-32967955 AGCCTGTCCCATAAGGACAAAGG + Intergenic
952591647 3:34962478-34962500 AGGCTGCTCTAGAGGGAGATTGG + Intergenic
953609448 3:44435256-44435278 AGGCTGTCCAGTGAGGAGATGGG - Intergenic
954663447 3:52238052-52238074 AGCCTGTCCAAGAAGGAAACTGG + Intronic
955059474 3:55483244-55483266 AGGGTGTCCCAAAGGGGGATCGG + Intronic
955947325 3:64207923-64207945 AGGCTGACGCAGGAGGAGCTGGG + Intronic
958518766 3:95157082-95157104 AGGAGGTCACAGATGGAGATAGG - Intergenic
960753402 3:120982168-120982190 TGGCTGTGGCAGAAGCAGATGGG + Intronic
961466135 3:127082772-127082794 AGGCTGACCCAGGAGGAGGGAGG + Intergenic
962417500 3:135196449-135196471 AGGCAGTGCCAGGAGGAGAGGGG + Intronic
962464742 3:135647816-135647838 GGGGTGTCCCTGAAAGAGATGGG - Intergenic
963735470 3:149013891-149013913 AGGCTGACTCAGAAAGAGTTTGG + Intronic
964047891 3:152353278-152353300 AGGCTGTGTCAGAGAGAGATGGG + Intronic
964897131 3:161612182-161612204 AGGTGGTCTCAGATGGAGATAGG + Intergenic
966169866 3:177067285-177067307 AGGATTTCCCAAAATGAGATGGG + Intronic
966737861 3:183203626-183203648 TGGCAGTCTCAGAAGGAGAGAGG + Intronic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
966921072 3:184611728-184611750 ATTCTGTCCTAGAAGGAAATTGG + Intronic
967297907 3:187983544-187983566 AAGCTCTCCCAGAAGGACACTGG - Intergenic
967544008 3:190702262-190702284 AGGCAGACCCAGAAGAAAATAGG - Intergenic
967918600 3:194597858-194597880 TGGCTGTCCCAGAAAGTGAGGGG + Intronic
969559989 4:7940653-7940675 AGGCCCTCCCTGAAGGAGCTCGG + Intergenic
970306180 4:14734730-14734752 AGGTGGTCTCAGATGGAGATGGG - Intergenic
970320959 4:14874963-14874985 CAGCTGTGCCAGAAGAAGATGGG + Intergenic
973055235 4:45649095-45649117 TGGCTTCCCCAGCAGGAGATTGG - Intergenic
973718517 4:53701059-53701081 AGGTGGTCTCAGATGGAGATGGG - Intronic
974169898 4:58252510-58252532 AGGCAGTCCCAGATGGAGATGGG - Intergenic
974215459 4:58841352-58841374 AGGTGGTCTCAGATGGAGATGGG + Intergenic
975746426 4:77479940-77479962 AGGGTGTCTCTGAAAGAGATTGG + Intergenic
978983590 4:114982339-114982361 AGGTGGTCTCAGATGGAGATGGG + Intronic
979968425 4:127105638-127105660 AGTTTGTCACAGAATGAGATTGG + Intergenic
980646033 4:135643521-135643543 AGGTGGTCTCAGATGGAGATGGG + Intergenic
984900441 4:184581451-184581473 AGGTGGTCTCAGATGGAGATGGG - Intergenic
986311824 5:6556901-6556923 AGGCCCCCTCAGAAGGAGATGGG + Intergenic
988167457 5:27612898-27612920 AGCCTTTGACAGAAGGAGATGGG - Intergenic
988631725 5:32938522-32938544 CTGCTGTCCTAGAAGGAGATGGG + Intergenic
988865140 5:35325881-35325903 CTGGTGTCCCAGAAAGAGATGGG + Intergenic
991116942 5:62965162-62965184 AGGCTGGCTCAGAAGAAGACAGG - Intergenic
993128411 5:83863986-83864008 AGGCAGAGCCAGAAGTAGATCGG - Intergenic
993711648 5:91230974-91230996 AGGTGGTCTCAGATGGAGATGGG - Intergenic
996288010 5:121817914-121817936 GTGCTGTCCCAGAAGCAGAGAGG + Intergenic
999193005 5:149762697-149762719 AGGCTGTCCCCAAATGAAATAGG - Intronic
999310268 5:150547306-150547328 GGCCTGTCTCAGAAGGAGGTCGG + Intronic
1000098168 5:157989176-157989198 AGGTTGACCAATAAGGAGATAGG + Intergenic
1002668702 5:180847096-180847118 TAGGAGTCCCAGAAGGAGATGGG + Intergenic
1004268777 6:14175235-14175257 CTGCTGTCCCAGAAGCAGCTGGG + Intergenic
1005991552 6:30905990-30906012 ACCCTGTCCCAAAAGGAGAGGGG - Intergenic
1009825334 6:68859215-68859237 AGGTGGTCTCAGATGGAGATGGG - Intronic
1010913370 6:81586388-81586410 AGGTGGTCTCAGATGGAGATGGG - Intronic
1011870383 6:91885703-91885725 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1017920421 6:158867831-158867853 AAGCGGGCCCAGAAGGAGTTGGG - Intergenic
1019370359 7:660036-660058 AGGCTCTCCCAGCAGGAGAGAGG + Intronic
1019534532 7:1521932-1521954 AGGCTGTCACAGAGGGACTTGGG + Intergenic
1019729567 7:2622720-2622742 AGGCTGGGGCAGGAGGAGATGGG - Intergenic
1021441711 7:20684936-20684958 TGACTTTCCCAGGAGGAGATGGG - Intronic
1021505382 7:21378231-21378253 AGGCTCACCCAGAAAGAGAATGG - Intergenic
1024220245 7:47281415-47281437 AGTCATTCCCAGAAGGAGAGGGG - Intronic
1024427099 7:49239001-49239023 TTGATGTCCCAGAAAGAGATGGG - Intergenic
1024755066 7:52519468-52519490 AGGAGGTCTCAGATGGAGATGGG - Intergenic
1028209739 7:88059108-88059130 ATGCTGTCCAACCAGGAGATTGG + Intronic
1028505495 7:91566016-91566038 AGGCTCTGCCAGGAGGAGACAGG + Intergenic
1028668435 7:93373060-93373082 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1029157359 7:98526581-98526603 AGCCTGTGCCAGAATGAGGTAGG - Intergenic
1030357414 7:108557597-108557619 AGGAGGTCTCAGATGGAGATGGG - Intronic
1030545527 7:110890185-110890207 AGAGTGTCCCAGAAGGACGTAGG - Intronic
1030807459 7:113935327-113935349 TTGATGTCCCTGAAGGAGATGGG - Intronic
1031608160 7:123794066-123794088 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1031951041 7:127892477-127892499 AGGGTTTCCCAGAAGCAGAGAGG - Intronic
1034004395 7:147453115-147453137 AGGCTTTGCCAGCAGGAGAAAGG - Intronic
1034234622 7:149557094-149557116 AGGCTCCCCCAGAAACAGATGGG + Intergenic
1034276964 7:149828105-149828127 AGACTGTCCCAGGGGGAGAGCGG - Intergenic
1034538470 7:151740533-151740555 AGTCAGTCCCAGCAGGAGAAAGG - Intronic
1035618633 8:1021751-1021773 GGGGTGTCCCACAGGGAGATGGG - Intergenic
1037444894 8:18955679-18955701 AGGCTGTCCCAGGAGTGGACAGG + Intronic
1038362395 8:26893986-26894008 AGGCTGCACCAGAAGGTGAGTGG + Intergenic
1040013500 8:42681767-42681789 AAGCTGCCCCAGAAGCAGATGGG - Intergenic
1041730119 8:61054235-61054257 AGGCTGCTGCAGGAGGAGATAGG - Intergenic
1043680880 8:83023082-83023104 AGGAGGTCTCAGATGGAGATGGG - Intergenic
1044949364 8:97420140-97420162 AACATGTCCCACAAGGAGATAGG - Intergenic
1045750200 8:105474894-105474916 TGGGTTTCCCAGAGGGAGATAGG - Intronic
1045888611 8:107127967-107127989 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1045962333 8:107982796-107982818 ATGATGTCCCAGAAGCAGAATGG - Intronic
1046211963 8:111087760-111087782 AGGATGTTTCTGAAGGAGATTGG - Intergenic
1046607512 8:116388203-116388225 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1047060542 8:121219982-121220004 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1047368853 8:124238242-124238264 AGACTGTCCCAGAAGCAGCCAGG + Intergenic
1049403184 8:142439990-142440012 AGGCAGTCTCAGGAGGAGCTCGG - Intergenic
1049414948 8:142490868-142490890 AGGCTGGCCCAGTAGGGGAGGGG + Intronic
1050976910 9:11950192-11950214 AGGTAGTCTCAGATGGAGATGGG - Intergenic
1052142343 9:25003046-25003068 GTGGTGTCCCTGAAGGAGATGGG - Intergenic
1053292534 9:36890796-36890818 AGGCACTTACAGAAGGAGATGGG + Intronic
1053622396 9:39833077-39833099 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1053882742 9:42612103-42612125 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1053889927 9:42682199-42682221 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1054221769 9:62419571-62419593 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1054228945 9:62489602-62489624 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1055596428 9:77869774-77869796 AGGCATTCCCAGAAGGAGATGGG - Intronic
1055668265 9:78573764-78573786 GGGCGGTTCCAGAAGGAGAGGGG + Intergenic
1057046298 9:91888879-91888901 AGGCTGTCCACGAAGCAGGTTGG + Intronic
1058313724 9:103537677-103537699 AGGCTGGCCTAGAATGAGTTAGG - Intergenic
1059340404 9:113594652-113594674 AGGCTTTCACAGAGGGAGCTGGG + Intronic
1059628231 9:116091080-116091102 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1060109636 9:120897305-120897327 AGGCTGGCCCAGAGGCAGATGGG + Intergenic
1061313367 9:129778337-129778359 AGGATGTCTCCAAAGGAGATGGG + Intergenic
1061623339 9:131825510-131825532 AGCCTGTGCCAGAAGGAGTGTGG - Intergenic
1062559968 9:137137110-137137132 AGGTTGTCCATGATGGAGATGGG - Intergenic
1186712406 X:12213060-12213082 TGGCTGTCCCAGGACCAGATGGG - Intronic
1191095645 X:56670742-56670764 AGGATATCCCAGAAGGAGAGAGG - Intergenic
1192174568 X:68877839-68877861 AGGTTGTGCCAGGAGGAGCTGGG + Intergenic
1192934983 X:75849914-75849936 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1193316610 X:80072267-80072289 AGGTGGTCTCAGATGGAGATAGG - Intergenic
1194778279 X:97992029-97992051 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1194952566 X:100144620-100144642 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1195228508 X:102822673-102822695 AGGATGTCCCTGAAGGACAATGG + Intergenic
1196114433 X:111983710-111983732 AGGATGTCCCTTAAGGAGAGTGG - Intronic
1196582903 X:117396287-117396309 AGGTAGTCTCAGATGGAGATGGG - Intergenic
1198693226 X:139307099-139307121 AGGTGGTCTCAGATGGAGATAGG + Intergenic
1198991629 X:142521147-142521169 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1199078525 X:143550992-143551014 AGGTAGTCTCAGATGGAGATGGG + Intergenic
1202336894 Y:23821289-23821311 AGACTGTAGCAGAAGGACATTGG - Intergenic
1202533871 Y:25848782-25848804 AGACTGTAGCAGAAGGACATTGG + Intergenic