ID: 1097107082

View in Genome Browser
Species Human (GRCh38)
Location 12:56632305-56632327
Sequence GGGCGGCGGGATGGGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1067
Summary {0: 1, 1: 0, 2: 6, 3: 112, 4: 948}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097107068_1097107082 28 Left 1097107068 12:56632254-56632276 CCAAATAAAAAATTAAGGCAGGT 0: 1
1: 0
2: 1
3: 36
4: 353
Right 1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG 0: 1
1: 0
2: 6
3: 112
4: 948
1097107066_1097107082 29 Left 1097107066 12:56632253-56632275 CCCAAATAAAAAATTAAGGCAGG 0: 1
1: 0
2: 3
3: 54
4: 756
Right 1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG 0: 1
1: 0
2: 6
3: 112
4: 948
1097107065_1097107082 30 Left 1097107065 12:56632252-56632274 CCCCAAATAAAAAATTAAGGCAG 0: 1
1: 0
2: 1
3: 59
4: 782
Right 1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG 0: 1
1: 0
2: 6
3: 112
4: 948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097107082 Original CRISPR GGGCGGCGGGATGGGGGTGT GGG Intronic
900091795 1:923996-924018 GGGCGGCGGGGCGGGGGCTTGGG + Intergenic
900147932 1:1166526-1166548 GGGGGTGGGGGTGGGGGTGTGGG - Intergenic
900255796 1:1697743-1697765 GGGAGGCAGGGTGGGGGTGCCGG + Intronic
900264467 1:1750353-1750375 GGGAGGCAGGGTGGGGGTGCCGG + Intergenic
900268978 1:1777607-1777629 GGGAGGAGGGATGGGAGGGTGGG + Intronic
900291144 1:1924141-1924163 GGGCGGTGAGCTGGGGGGGTGGG - Intronic
900291209 1:1924328-1924350 GGGCGGTGAGCTGGGGGAGTAGG - Intronic
900291754 1:1926611-1926633 GGGCACCGGGGTGGAGGTGTGGG + Intronic
900307695 1:2019204-2019226 GGGGGGCGGGATGGGGCGGGGGG + Intergenic
900418629 1:2546215-2546237 GGGCGGGGGGAGCGGGGAGTGGG + Intergenic
900502332 1:3012599-3012621 AGGCGGCGGGGTGGGGGCGGTGG - Intergenic
900531193 1:3154277-3154299 GGGCGGCGTGGTGGGGGGGCAGG + Intronic
900547210 1:3235727-3235749 GGACGGCGGGGGCGGGGTGTGGG + Intronic
900703133 1:4060327-4060349 GGGAGGCGGGAGAGGGGTGGAGG + Intergenic
901125100 1:6923652-6923674 TGGCGGTGAGCTGGGGGTGTTGG + Intronic
901179993 1:7335147-7335169 GGGGGGGGGGGTGGGGGTGGGGG + Intronic
901361086 1:8701261-8701283 AGGCACCGGGATGGGGGTGAGGG + Intronic
901384325 1:8897308-8897330 GAGCGGCTGGAAAGGGGTGTTGG - Intergenic
901630285 1:10644665-10644687 GGGCGGCTGTCTGGGGGTGGAGG + Intronic
901736009 1:11312625-11312647 GGGCGGGGGTGTCGGGGTGTTGG + Intergenic
901757699 1:11451281-11451303 GGGAAGCGGGAGGGTGGTGTAGG + Intergenic
901843223 1:11966448-11966470 GGGCGGCAGGATGGGAGTTGGGG + Intronic
901843233 1:11966469-11966491 GGGTGGCGGGATGGGAATGGGGG + Intronic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
901843256 1:11966512-11966534 GGGTGGTGGGATGGGGGTGGGGG + Intronic
902217175 1:14941544-14941566 GGGGGGTGGGATGGGGGTGTGGG + Intronic
902242006 1:15095596-15095618 GTGGGGCGGGGTGGGGGTGGGGG - Intronic
902272292 1:15313324-15313346 GGGCGGGGTGGTGGGGGGGTGGG + Intronic
902292984 1:15447148-15447170 GTGCTGCGGGGTGGGGGTGGGGG - Intronic
902304297 1:15524914-15524936 TGGGGGCGGGGTGGGGGCGTGGG - Intronic
902542968 1:17167304-17167326 GGGCGGGGGGGGGGCGGTGTGGG - Intergenic
902691015 1:18110097-18110119 GGGCTGCGGGAGGCGGGGGTTGG + Intronic
902842865 1:19086332-19086354 GGGCGGGGGGGCGGGGGTGGGGG + Intronic
902919333 1:19657030-19657052 GGGGGTGGGGATGGGGGTGAGGG - Exonic
903171755 1:21558717-21558739 GGGCTGAGGGATTGGGGTGGTGG + Intronic
903327311 1:22576859-22576881 GAGCGGCGGGATGCCTGTGTGGG + Exonic
903651759 1:24926925-24926947 GGAAGGCGGGACGGGGGTGGGGG - Intronic
903846191 1:26280937-26280959 GGGCTGGGGGACGGGGGGGTGGG + Intronic
903855540 1:26336058-26336080 GGGCGGAGGGCTGGGGGCGCTGG - Intronic
904694533 1:32321363-32321385 GGGTGGGGGGCTGGGGGAGTGGG - Intronic
904944241 1:34187767-34187789 GGGCGGCGGGGGGGGGGGGGTGG - Intronic
905127427 1:35725522-35725544 GGGCGGCCGGAGGGTGGGGTGGG - Intronic
905174037 1:36125227-36125249 GGGCGGCAGGAGGGGCGCGTCGG + Intergenic
905480946 1:38261575-38261597 GGGCTGCAGGTTGGGGGTGATGG + Intergenic
905775266 1:40664238-40664260 GGGAGGCGGGGTGGGTGGGTTGG - Intronic
905863373 1:41364419-41364441 TGGCGGGGGGGTGGGGGGGTGGG + Intronic
906083123 1:43107487-43107509 GGGCGGGGGGCAGGGGGTGGTGG + Intergenic
906095861 1:43223440-43223462 GGGAGAGGGAATGGGGGTGTAGG + Intronic
906544545 1:46612053-46612075 GGGCAGCAGGAGGGGGTTGTTGG - Intronic
906682503 1:47738939-47738961 GGGTGGGGGGGTGGGGGTGGTGG + Intergenic
906942814 1:50271294-50271316 GGGGGGCGGGGTGGTGGTGCAGG - Intergenic
907414079 1:54302037-54302059 GGGCGGCTGGGTGGGGGTGGGGG + Intronic
908508316 1:64828154-64828176 GGGCGGGGGGTGGGGGGGGTGGG - Intronic
908806829 1:67940304-67940326 GGGAGGCATGCTGGGGGTGTGGG + Intergenic
909228085 1:73051236-73051258 GGGAGGGTGGATGGGGGTGAGGG + Intergenic
910288493 1:85578842-85578864 GGGGGGCGGGAGGGGGGAGGAGG - Intergenic
910807512 1:91203576-91203598 GTTCTGCGGCATGGGGGTGTTGG - Intergenic
911408532 1:97471875-97471897 GGGGGACGGGATGGGCGTGGTGG - Intronic
911685238 1:100768211-100768233 GGGTGGAGGGATGGGGGGATAGG + Intergenic
911995219 1:104758078-104758100 GGGAGGGGGGATGGGGGAGGGGG + Intergenic
911995240 1:104758113-104758135 GGGTGGGGGGATGGGGGTGGGGG + Intergenic
912384384 1:109263976-109263998 GGGCAGCGGGATGGGTTTGATGG + Intronic
913154816 1:116085624-116085646 GGACAGTGGGATAGGGGTGTGGG - Intergenic
913427797 1:118753883-118753905 GGAAGGTGGGAAGGGGGTGTGGG - Intergenic
913939237 1:125086694-125086716 CGGCGGCGGCAGGGGGGTGGGGG + Intergenic
914743856 1:150486897-150486919 GGGGGGCGGGAGGGGGGGGCGGG - Intergenic
915213291 1:154325480-154325502 GGGGGGCGGGAGGGGGTTTTGGG - Intergenic
915302046 1:154957252-154957274 GAGCAGCGGGGTGGGGGTGGGGG + Exonic
915309593 1:155000636-155000658 GGGCGGGGGGCGGGGGGGGTGGG - Intergenic
915530472 1:156499986-156500008 GGGCGGCGGGAGGGTGGAGGCGG - Intronic
915554501 1:156653954-156653976 GGGCTAGGGGATGGGGGTGAGGG - Intronic
915594799 1:156890377-156890399 GGGCGACTGGATGGTGCTGTTGG - Intergenic
915623954 1:157103269-157103291 GGGAGTCGGGGAGGGGGTGTTGG - Intergenic
915978901 1:160408152-160408174 GGGAGCTGGGATGGGGGTGGGGG + Intronic
917002610 1:170375957-170375979 GGGTGGGGGGATGGGGGGGTGGG + Intergenic
918093659 1:181317611-181317633 GGGCGGCGGGCGGGGGGAGGGGG - Intergenic
918171704 1:182003929-182003951 GGGCGCGGGGTTGGGGGGGTGGG + Intergenic
919805299 1:201377780-201377802 GGGCAGGGGGATGGCGGTGGGGG + Intronic
920102423 1:203525685-203525707 GGGCTTGGGGATGGGGGTGAGGG + Intergenic
920333662 1:205229542-205229564 GGGCGGGGGGGGGGGGGTGGTGG + Intronic
920333876 1:205230985-205231007 GGGGGGGGGGATGGGGGGATGGG - Intronic
920380775 1:205533354-205533376 GGGCAGCAGGACGAGGGTGTGGG + Intergenic
920416163 1:205800528-205800550 GGCCGGGGGGCTGGGGGTGCTGG + Intronic
920556253 1:206907084-206907106 GGGTGGGGGGGTGGGGGGGTGGG + Intronic
920850524 1:209625223-209625245 TGCTGGTGGGATGGGGGTGTGGG + Intronic
921936664 1:220802302-220802324 GGGAGGTGGGGTGAGGGTGTAGG - Intronic
922794946 1:228335307-228335329 GGGTGGGGGGATGGGGGGATGGG + Intronic
923565912 1:235075802-235075824 GGGAAGTGGGATGGGGGTTTGGG - Intergenic
924436846 1:244049351-244049373 GGGCGGCGGGCTGGGGGAGGGGG + Intronic
924740341 1:246791103-246791125 GGCCAGCGGGATGGGGTGGTGGG + Intergenic
924801508 1:247331991-247332013 GCGGGGCGGGCCGGGGGTGTCGG - Intergenic
1062831508 10:608563-608585 GGGGGGGGGGATGTGTGTGTGGG - Intronic
1062932278 10:1361184-1361206 GGGAGGGGGGATGGGGGGGTGGG - Intronic
1063592942 10:7409954-7409976 GGGCGGTGGGAAGGGGCTGGAGG - Intronic
1063960419 10:11301519-11301541 GGGCAGCGGGAGCGGGGTGGGGG - Intronic
1063964444 10:11335710-11335732 GGGAGGTGGGAGGGGGATGTTGG + Exonic
1064231800 10:13535848-13535870 GGGCGGCGGGGGGAGGGTGGGGG - Intergenic
1064294785 10:14069027-14069049 GGGGGTGGGGATGGAGGTGTTGG - Intronic
1065501964 10:26391871-26391893 GGGGGGCGGGAAGGGGCTGGTGG - Intergenic
1066065655 10:31759575-31759597 GTGCTGGGGGATGGGTGTGTTGG + Intergenic
1066321773 10:34309739-34309761 GGGCGGGGGGGTGGGGGAGATGG - Intronic
1067373177 10:45703540-45703562 GGTCGGGGGGGTGGGGGTGATGG + Intergenic
1067386599 10:45822582-45822604 GGTCGGGGGGGTGGGGGTGATGG - Intergenic
1067447670 10:46362018-46362040 GGTCGGGGGGGTGGGGGTGATGG + Intergenic
1067480937 10:46597395-46597417 GGGAGGGGGGAAGGGGGGGTTGG - Intergenic
1067589709 10:47498742-47498764 GGTCGGGGGGGTGGGGGTGATGG - Intergenic
1067636833 10:48006849-48006871 GGTCGGGGGGGTGGGGGTGATGG - Intergenic
1067733230 10:48828932-48828954 GGGGGGCGGGGAGGGGGTGGTGG + Intronic
1067987836 10:51170761-51170783 GGGTGGGGGGGTGGGGGAGTTGG + Intronic
1068018312 10:51545883-51545905 GGGGTGCTGGGTGGGGGTGTAGG - Intronic
1068080841 10:52315152-52315174 GGGCGGGGGGTTGGGGGGGGTGG + Intronic
1069111800 10:64456737-64456759 GGGAGGGGGGATGGGGGAGGGGG - Intergenic
1069879540 10:71583238-71583260 GGGAGGCGGGGTGGGGGCGGGGG + Intronic
1070159214 10:73855542-73855564 GGGCGGGGGCAGGGTGGTGTGGG - Intronic
1070771449 10:79084860-79084882 GGGTGGTGGGGTGGGGGTGGGGG + Intronic
1070800666 10:79242978-79243000 GGGCGGCGGGCTGGGGGGCGGGG + Intronic
1070813946 10:79311810-79311832 GGGCTGCTGGATGGGGCTGGCGG + Intronic
1071530540 10:86387940-86387962 GGGGGGAGGGTTGGGGGTGGTGG - Intergenic
1071613913 10:87056981-87057003 TGGCGGGGGGAGGGGGGTGGCGG + Intronic
1071956141 10:90761793-90761815 TGGCAGGGGGATGGGGATGTGGG - Intronic
1073035722 10:100562970-100562992 GAGCGGGGAGGTGGGGGTGTGGG + Intergenic
1073225657 10:101916358-101916380 GGGAGCTGGGATGGGGGTGGGGG - Intronic
1073377652 10:103050657-103050679 GGGCAGTGGGTCGGGGGTGTGGG + Intronic
1073553585 10:104426416-104426438 CGGCGGGGGGAAGGAGGTGTGGG - Intronic
1074046936 10:109848057-109848079 GGGCGGTGGGGTGGGTGTGGGGG - Intergenic
1074086133 10:110210039-110210061 GGGCGGCGGGGTGGGGGGTGGGG - Intronic
1074165567 10:110871653-110871675 GCGTGGCGGGATGGGAGCGTTGG - Intergenic
1075016046 10:118910575-118910597 GGGGGGGGGGATGGGGGTGGGGG + Intergenic
1075363480 10:121861594-121861616 GGGTGGCGGGAGGGGGGAGGGGG + Intronic
1075679338 10:124321386-124321408 GGGCGGAGGGGTGGGGGTGGTGG - Intergenic
1076285484 10:129292057-129292079 GGGGCGGGGGCTGGGGGTGTTGG - Intergenic
1076336874 10:129712818-129712840 AGGCAGCAGGATGGGGTTGTAGG - Intronic
1076659720 10:132047671-132047693 GGGGGGCGGGACGGGAGGGTGGG - Intergenic
1076683593 10:132187124-132187146 GGGCGGCGGGCAGGGGGCGCCGG - Intronic
1076686251 10:132199685-132199707 GGGGGGCGGGGTGGTGGTGGTGG + Intronic
1076791794 10:132780734-132780756 GGGCAGAGAGATGGGGATGTCGG - Intronic
1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG + Intergenic
1076815395 10:132912113-132912135 GGGTGGGGGGGTGGGGGTGGAGG - Intronic
1076867512 10:133175288-133175310 GGGTGGCTGGATGGGTGGGTGGG + Intronic
1076948546 10:133666873-133666895 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076949530 10:133670172-133670194 GGCCGGCGGGGTGGTGGTGGTGG - Intronic
1076950514 10:133673471-133673493 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076951504 10:133676781-133676803 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076952494 10:133680091-133680113 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076953477 10:133683390-133683412 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076955450 10:133743052-133743074 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076956440 10:133746362-133746384 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076957428 10:133749671-133749693 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076958412 10:133752970-133752992 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076959401 10:133756280-133756302 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076960385 10:133759579-133759601 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1077048351 11:555796-555818 GCGCGGCGGCTTGCGGGTGTCGG + Exonic
1077063108 11:626354-626376 GGGGGGCAGGATGGGGGAGAGGG - Intergenic
1077089354 11:771424-771446 GGGCTGCGGGAGCGGGGTGGGGG + Exonic
1077090544 11:776597-776619 GGACGGGGAGATGGGGCTGTGGG - Intronic
1077107785 11:849507-849529 GGGGGAAGGGCTGGGGGTGTCGG + Intronic
1077365934 11:2161617-2161639 GGGTGTGGGGATAGGGGTGTGGG - Intergenic
1077460944 11:2709224-2709246 GGGCTGGGGGGTGGGGGTGGGGG - Intronic
1077548700 11:3189396-3189418 GGGAGGCGGGTGGGGGGTGGGGG + Intergenic
1077865385 11:6217715-6217737 AGGGGGCGGGCTGGGGGTGCAGG - Exonic
1078340852 11:10497144-10497166 GTGTGGGGGGATGGGGGTGGTGG + Intronic
1078422088 11:11220820-11220842 GGGTGGCGGGGTCGGGGAGTGGG + Intergenic
1078594585 11:12674985-12675007 GGGCGCGGGGAGGCGGGTGTGGG - Intronic
1078891363 11:15561189-15561211 GGGGGGCGGGGAGGGGGTGGTGG - Intergenic
1079011906 11:16835368-16835390 GGACTGAGGGATGGGGCTGTAGG + Intronic
1079136281 11:17777480-17777502 GGGCTGAGGGAGGAGGGTGTTGG - Intronic
1079343475 11:19632053-19632075 GGCAGGCAGGGTGGGGGTGTGGG + Intronic
1080230667 11:30015862-30015884 GGGCGCCGGGATTGGGGAATAGG - Intronic
1080649347 11:34209853-34209875 GGGGTGAGGGATGGGGGTGAGGG + Intronic
1081313761 11:41605214-41605236 GGGTGGAGGGATGGGGGTTTGGG + Intergenic
1081406556 11:42705435-42705457 CAGCGGCGGGATGGGGCGGTGGG - Intergenic
1081832095 11:46122132-46122154 CGCCGGCGGGAGGGGGGAGTTGG - Intergenic
1081854856 11:46296735-46296757 GGCAGGCGGGGTGGGGGTGGAGG - Intronic
1081909919 11:46694240-46694262 GGGAGGTAGGATGGGGGTGGGGG - Intronic
1081929432 11:46858534-46858556 GGGCTGGGACATGGGGGTGTGGG - Exonic
1082107821 11:48239907-48239929 GGGAGGGTGGGTGGGGGTGTTGG - Intergenic
1082140063 11:48598752-48598774 GGGCGGGGGGAGGGGGGAGGGGG - Intergenic
1082734339 11:56839278-56839300 GGGCGGGGGGTTGGGGGCATGGG - Intergenic
1082807140 11:57458599-57458621 CGGCGGCGGGGAGGGAGTGTTGG - Intergenic
1083609730 11:63999165-63999187 CGGTGGCGAGATGGGGGTGATGG - Intronic
1083827631 11:65212255-65212277 GGGCGGCGGGGAGGGCATGTAGG - Intergenic
1083853307 11:65379963-65379985 GGGTGGCGGGATGGGCAGGTGGG + Intronic
1083992888 11:66257773-66257795 GGCCGGCGGGATGGAGGCGGCGG + Intronic
1083996302 11:66274753-66274775 GGGAGGGGGAATGGGGGAGTGGG - Intronic
1083997349 11:66278859-66278881 AGGCGGCTGGATGGTGGTGGGGG - Intronic
1084041779 11:66546801-66546823 GAGGGGCCGGATGGGGGTGAAGG - Intronic
1084332878 11:68439940-68439962 GCGGGGCGGGATGGGGCTGTGGG + Intronic
1084364269 11:68687455-68687477 GGGAGACAGGATGGGGGTGGGGG - Intronic
1084403019 11:68956011-68956033 CGGGGGCAGGATGGGGGTGCTGG + Intergenic
1084694838 11:70746944-70746966 GGGTGGAGGGAGGGGGGTGGAGG - Intronic
1084864042 11:72041319-72041341 GGGCGGCGGGTTGAGGGTGAAGG + Intronic
1084916974 11:72435804-72435826 AGGGGGCGGGATGGGAGTGCAGG - Intergenic
1084964346 11:72736655-72736677 GAGAGGCAGGATGGGGGTGTGGG - Intronic
1088139229 11:106595567-106595589 GGGGTGGGGGATGGGGATGTAGG + Intergenic
1088777958 11:113104213-113104235 GGGGGGCGGGGTGGTGGTGGCGG + Intronic
1088912062 11:114199309-114199331 GGGCCCCGGGATGGGGATGCCGG + Intronic
1089015361 11:115161016-115161038 GGAGGTGGGGATGGGGGTGTTGG - Intergenic
1089041250 11:115452150-115452172 GGGTGGTGGGGTGGGGGGGTGGG + Intronic
1089171000 11:116511442-116511464 GGGCATCGGGGTGGGGGTGGGGG + Intergenic
1089496446 11:118910611-118910633 AGGGGGCGGGGTGGGGGTGCAGG - Exonic
1089502636 11:118941201-118941223 GGGTGGCGGGGTCGGGGGGTTGG + Intronic
1090195426 11:124812233-124812255 GGGTGCCGGGTGGGGGGTGTCGG + Intergenic
1090362852 11:126185544-126185566 GTGCGGTGGGCTGGGGGTGAGGG - Intergenic
1090628255 11:128624516-128624538 GGGCAGCGGGGTTGGGGGGTGGG + Intergenic
1091035042 11:132225225-132225247 GGGCTGCAGTATGGGAGTGTAGG + Intronic
1091241127 11:134053139-134053161 GGGCGGGGGGGGGGGGGTGGAGG + Intergenic
1091446384 12:546202-546224 GAGAGGAGGGAGGGGGGTGTGGG + Intronic
1091460812 12:642661-642683 GGGGGGCGGGCTGGGAGTGGGGG + Intronic
1091838566 12:3602976-3602998 GGGTGGAGGAATGGGGGTGGGGG - Intergenic
1092060583 12:5547315-5547337 GGGAGGTGGGATGGGGAAGTGGG + Intronic
1092181797 12:6451427-6451449 GGTCGGCGGGGTGGGGGTGGAGG - Exonic
1092218391 12:6697673-6697695 GGGGGGCGGGCTGGGGCTGGTGG + Exonic
1092282586 12:7108992-7109014 GGGGGGGGGGATGTGTGTGTGGG + Intronic
1092483361 12:8880443-8880465 GTGGGGCGGGGTGGGGGCGTGGG + Intronic
1092539799 12:9413641-9413663 GGGCGGGGGGCGGGGGGTGGGGG + Intergenic
1093346044 12:18039073-18039095 GAGCGGCTGGAAAGGGGTGTTGG - Intergenic
1093396060 12:18683936-18683958 GGAAGGTGGGGTGGGGGTGTGGG - Intronic
1093896932 12:24584330-24584352 GGGCGGGAGGGTGGGGGTGGGGG - Intergenic
1094482398 12:30895248-30895270 GGGAGGAGGGCTGGTGGTGTTGG - Intergenic
1094554993 12:31490235-31490257 GGGCGAGAGGATGGGGGTGGCGG + Intronic
1095687494 12:45051521-45051543 GGAGGGCGGGGTGGGGGTGGGGG + Intergenic
1095967561 12:47879192-47879214 GGGCGGTGGGATGAGGCTGGGGG - Intronic
1096258155 12:50075156-50075178 GGACTGAGGGATGGGTGTGTGGG - Intronic
1096578402 12:52569255-52569277 GGGCGGGGGGGTGGGGGTGGGGG - Intronic
1096660821 12:53123001-53123023 GGGCGGGGGGCTGGAGGTGGGGG + Intronic
1096677257 12:53232353-53232375 GGGCGGAGGGATGGGTGGGCGGG + Intronic
1096784832 12:54010881-54010903 GGGAGGTGGGGTGGGGGTGGGGG - Intronic
1096848110 12:54418943-54418965 TGGAGACGGGATGGGGGTGGGGG - Intronic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1097246980 12:57612026-57612048 GGGGGGCGGGCTGGGGGTTCAGG + Intronic
1097647975 12:62259979-62260001 GGGCGGTGGTGTGGGGGCGTGGG - Intronic
1097863923 12:64543498-64543520 GGGCGGCGGGGGGAGGGTGTGGG - Intergenic
1098275461 12:68807995-68808017 GTGAGGCGGGGTGGGGGTGTTGG - Intergenic
1098312108 12:69158762-69158784 GGGCGGCGGGGTGGGGGCGGCGG - Intergenic
1099665250 12:85619966-85619988 GGCCGGGGGGCTGGGGGTGGTGG + Intergenic
1101486869 12:105173416-105173438 GGGAGGAGGGATGGGGGAGTGGG + Intronic
1101548070 12:105735508-105735530 GGGTGGGGGGGTGGGGGGGTGGG + Intergenic
1101579828 12:106032693-106032715 TGGTGGTGGGGTGGGGGTGTTGG - Intergenic
1101583458 12:106064782-106064804 GTGGGGGGGGGTGGGGGTGTGGG - Exonic
1101705396 12:107216282-107216304 GAGCGGCTGGAAAGGGGTGTTGG - Intergenic
1102336241 12:112082783-112082805 GGGCGGGGGGTGGGGGGTGCGGG + Intronic
1102573566 12:113842285-113842307 GGGTTGGGGGATGGGGGTGGCGG + Intronic
1102795656 12:115687067-115687089 GGTAGGGGGGCTGGGGGTGTGGG - Intergenic
1102871214 12:116415813-116415835 GGGTGAGGGGATGGGGGCGTGGG + Intergenic
1103091207 12:118099308-118099330 GGGCGGCGGGTTGGGGTGGGGGG + Intronic
1103443523 12:120979950-120979972 GGGGTGGGGGATGGGGGTGTGGG + Intronic
1103473250 12:121198992-121199014 GGGCGGCGGGGGTGGGGGGTCGG - Intergenic
1103497579 12:121374701-121374723 GGGCGGGGGGCAGGGGGTGGGGG - Intronic
1103610834 12:122123276-122123298 TGGGGGCGGGCTGGGGGTGCAGG + Intronic
1103740592 12:123088540-123088562 GGGTGGCAGGAGGGTGGTGTGGG + Intronic
1103748691 12:123143857-123143879 GAGCTGCGGGATGAGGCTGTGGG - Intronic
1103892334 12:124249347-124249369 AGGGGGTGGGATGGGGGCGTGGG + Intronic
1103995440 12:124826953-124826975 GGGCTGGGGGCTGGGGATGTGGG + Intronic
1104412551 12:128571553-128571575 GGGCTGCGGGGAGGGGGAGTGGG - Intronic
1104839204 12:131813004-131813026 GGGCTGGGGGCTGGGGGTGAAGG - Intergenic
1104906042 12:132214027-132214049 AGGCGTGGGGATGGGGGTCTGGG + Intronic
1105019959 12:132809425-132809447 GGGCGGGGGGGCGGGGGTGGGGG - Intronic
1105389209 13:19959191-19959213 GGACGGCGGGGCGGGGGTGCCGG + Intronic
1107753396 13:43593638-43593660 GGGTGGCAGGGTGGGGGTGGGGG - Intronic
1107853209 13:44591253-44591275 GGGTGGCGGGCTGGGGCTGGGGG - Intergenic
1108320171 13:49281914-49281936 GGGTGGGGGGAGGGGGGTGGGGG - Intronic
1108825536 13:54408221-54408243 GGGATGGGGGATGGGGGTGAGGG - Intergenic
1111743293 13:92232271-92232293 GCGTGGTGGGGTGGGGGTGTGGG + Intronic
1111812621 13:93110408-93110430 GGGGAGCGGGGTGGGGGTGGGGG - Intergenic
1112953932 13:105036450-105036472 GGGAGGCGGGCTGGGGCTGAAGG - Intergenic
1113086383 13:106573358-106573380 GGGCAGGGGGTTGGGGGAGTTGG + Intergenic
1113542141 13:111116559-111116581 GGGGGGTGGGGTGGGGGTGGGGG + Intronic
1113552621 13:111204991-111205013 GCGGGGCGGGGTGGGGGGGTGGG - Intronic
1113571659 13:111362300-111362322 GGGAGGTGGGGTGGGGGTGAGGG + Intergenic
1113614601 13:111671408-111671430 GGGCGGGGGTAGGGGGGTGGCGG + Intronic
1113620068 13:111756322-111756344 GGGCGGGGGTAGGGGGGTGGCGG + Intergenic
1113788242 13:113014178-113014200 GGGTGGGGGGATGGGTGTGGGGG + Intronic
1114270569 14:21098107-21098129 GGGGGGCGGGGTGGGGGTGGCGG - Intronic
1114508608 14:23237778-23237800 CGGTGGCGGGAGAGGGGTGTAGG - Intronic
1114524466 14:23359444-23359466 GGCAGGCGGGGTGGGGGTGGGGG + Exonic
1114771307 14:25430731-25430753 GTGAGGCGGGGTGGGGGTGGGGG + Intergenic
1115028467 14:28767669-28767691 GGGCGGCGGGCCGGGGGAGCTGG + Exonic
1115398513 14:32934634-32934656 GCGCAGCGGGCTGGGGGTGGGGG - Intergenic
1115703394 14:35977064-35977086 GGGAGGCGGGGGGGGGGGGTCGG - Intergenic
1117449705 14:55838976-55838998 TGGGGGCGGGATGGGAGTGATGG + Intergenic
1117547576 14:56805713-56805735 GGGGGTGGGGATGGGGGTGGGGG - Intronic
1117684645 14:58240813-58240835 GGACGGGGGGGTGGGGGTGGGGG - Intronic
1118215845 14:63807992-63808014 GGAGGGTGGGATGGGGGTGAGGG - Intergenic
1118341167 14:64895689-64895711 GGGAGGCGGGGGGGGGGGGTCGG - Intergenic
1118480176 14:66156818-66156840 GGGGGGTGGGAGGGGGGTGGGGG - Intergenic
1118809375 14:69261801-69261823 GGGCGGGGGGGTGAGGTTGTGGG + Intronic
1118932443 14:70255097-70255119 GGGTGGCGGGGAGGGGGTGGGGG - Intergenic
1119421044 14:74508251-74508273 GGGCACCGGGGTGGGGGTGAGGG + Intronic
1119472051 14:74906406-74906428 GGGTGGGGGGGTGGGGGTGGGGG + Exonic
1119732026 14:76957120-76957142 GGGCTGAGGGAGGGGGGTGGGGG - Intergenic
1119777857 14:77259375-77259397 GGTCGGGGGGGAGGGGGTGTGGG + Exonic
1122328571 14:100897752-100897774 GGGGGGGGGGGTGGGGGGGTGGG + Intergenic
1122415163 14:101546073-101546095 GGCGGGCGGGGTGGGGGTGGGGG - Intergenic
1122422020 14:101583720-101583742 GGGCATCTGGATGAGGGTGTTGG + Intergenic
1122427391 14:101619949-101619971 GGGAAGTGGGATGGGGGTGTTGG - Intergenic
1122557615 14:102590177-102590199 GGGCAGCGGGATGGGGTCCTAGG + Intergenic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122716621 14:103700158-103700180 GGGGGTCAGGATGGGGCTGTAGG + Intronic
1122775792 14:104116546-104116568 GGGCTGCGGGGTGGGGGTTCAGG + Intergenic
1122779669 14:104138429-104138451 GGGCGGCGCGTGGGGGGGGTAGG - Intergenic
1122838962 14:104445353-104445375 GGGCCAGGGGATGGGGGTGCTGG - Intergenic
1122959608 14:105088348-105088370 GGGCGGAGGGCTGGGGGCGGGGG + Intergenic
1123035619 14:105470787-105470809 GGGCCGCCCGATGGGGGTGGGGG - Intergenic
1123048263 14:105528648-105528670 GTGCGGGGGGCGGGGGGTGTTGG + Intronic
1202862421 14_GL000225v1_random:90786-90808 GGGCGTGGTGATGGGGGTGGTGG + Intergenic
1123849749 15:24342865-24342887 GGGGGGCGGAGTGGGGGTGGTGG - Intergenic
1124959093 15:34381918-34381940 TGGGGGTGGGGTGGGGGTGTGGG - Intronic
1124971972 15:34496563-34496585 TGGCGGGGGGGTAGGGGTGTGGG + Intergenic
1124975719 15:34528139-34528161 TGGGGGTGGGGTGGGGGTGTGGG - Intronic
1125762614 15:42107291-42107313 GGTGGGCGGGGGGGGGGTGTCGG + Intergenic
1125834712 15:42738620-42738642 GGGCGGAAGGATGAGGGTGGGGG + Intergenic
1125919612 15:43517748-43517770 GGGAGGTGGGATGGGGGTCATGG + Intronic
1125927884 15:43578186-43578208 AGCAGGTGGGATGGGGGTGTGGG - Intronic
1125941027 15:43677751-43677773 AGCAGGTGGGATGGGGGTGTGGG - Intergenic
1126319613 15:47407925-47407947 TGGTGGTGGGGTGGGGGTGTTGG + Intronic
1127252598 15:57256549-57256571 GTGGGGCGGGGTGGGGGTGGGGG - Intronic
1127975037 15:63990883-63990905 TGGCTGTGGGATGTGGGTGTGGG - Intronic
1128153601 15:65378054-65378076 GGGCGGCGGGCTGGGGAGGAGGG - Intergenic
1128547792 15:68579345-68579367 GGGCGCGGGGGTGTGGGTGTGGG + Intronic
1128635431 15:69299396-69299418 GGGCGGCGGGAGGGGGGCGGTGG - Intronic
1128793729 15:70450288-70450310 GGGTGGATGGATGGGGGTGGAGG + Intergenic
1128892724 15:71345192-71345214 TGGCGGGGGGTTGGGGGGGTGGG + Intronic
1129256054 15:74334807-74334829 GGGTGGCGGGGTGAGGGTGAGGG - Intronic
1129313055 15:74725671-74725693 GGGCGGCGGGGGTGGGGGGTCGG + Intergenic
1129468502 15:75737695-75737717 CGGGGGCGGGGTGGGGGTGGAGG + Intergenic
1130302840 15:82693183-82693205 GGGCGGGGGGGTGGGGGCGGGGG - Intronic
1130569209 15:85025423-85025445 GGGGGGTGGGTAGGGGGTGTGGG + Intronic
1131091805 15:89629285-89629307 GGGGGGAGGGAGGGGGGTGCAGG + Intronic
1131133089 15:89912651-89912673 GGGGGGTGGGATGCGGGTGGGGG - Intronic
1131144554 15:90002378-90002400 GGGCGTGGGGGTGGGGGTGGCGG + Intronic
1131272607 15:90956366-90956388 GCGGGACGGGGTGGGGGTGTCGG + Intronic
1131396040 15:92087148-92087170 GGGCGGAGGGAGGGGGGTGGTGG - Intronic
1131582926 15:93663016-93663038 GGGGGGGGGGGTGGGGGTGGTGG + Intergenic
1131846507 15:96494978-96495000 AGGGGGAGGGATGGGAGTGTTGG + Intergenic
1132522422 16:397690-397712 GGGGGTGGGGGTGGGGGTGTGGG + Intronic
1132571172 16:644796-644818 TGGGCGCGGGAGGGGGGTGTCGG + Intronic
1132585808 16:705415-705437 AGGGGGCGGGGTGGGGGTGGGGG - Intronic
1132683816 16:1154058-1154080 GGGCGGGGGGCGGGGGGCGTGGG + Intronic
1132687699 16:1169156-1169178 CTGCGGCGGGGTGGGGGTGGGGG + Intronic
1132725953 16:1338455-1338477 AGGCGGGGGGGTGGGGGGGTGGG - Intronic
1132807780 16:1783011-1783033 AGGCGGCGGGATGGAGGCGGCGG + Exonic
1132939663 16:2500508-2500530 GGGCTCTGGGATGAGGGTGTGGG + Intronic
1132975059 16:2706885-2706907 GGGCGTCGGGGTGGGGGTGGGGG + Intronic
1132991879 16:2799589-2799611 GGGTGGGGTGATGGGGGTGCGGG + Intergenic
1133060394 16:3171066-3171088 GCGGGGCGGGAGGGGGGTGAGGG - Intergenic
1133448581 16:5884459-5884481 GGGCGGGGGTAGGGGGGTGGTGG - Intergenic
1133622381 16:7538850-7538872 GAGTGGCGGGGTGGGGGTGGGGG - Intronic
1133893402 16:9902959-9902981 TGGCGGGGGGGTGGGGGGGTGGG + Intronic
1134781009 16:16895685-16895707 GGGGGGCGGGGTGGGGGGGCGGG - Intergenic
1135048491 16:19173387-19173409 GGGCGGGGGGATGGGGGAGAGGG - Intronic
1135091538 16:19521952-19521974 GGGCGCCGGCATGTGGCTGTGGG - Exonic
1135274859 16:21103358-21103380 GGGGGGCAGGGTGGGGGAGTTGG + Intronic
1135777266 16:25267661-25267683 GGAGGGTGGGATGGGGGTGAAGG + Intergenic
1136141581 16:28292316-28292338 GCGCGGCCGGAAGGGGGTGGGGG + Intergenic
1136292683 16:29285329-29285351 GGGCAGGGGGATGGGGGCGCCGG - Intergenic
1136366075 16:29809785-29809807 GGGGGGCGGGATGGGGGGTGTGG + Intronic
1136530435 16:30864835-30864857 GGGTGGGGGGGTGGGGGTGGGGG - Intronic
1136579490 16:31142991-31143013 GGGCTGCGGGATGGGGGCCGAGG + Exonic
1136913089 16:34159899-34159921 GGGCGGTGGGAGGGGGGTGGTGG - Intergenic
1136994880 16:35182599-35182621 GGGTGGCAGGCTGGGGGTGATGG - Intergenic
1137267982 16:46884374-46884396 GGGCGCGGGGATGCGGCTGTGGG + Exonic
1137448609 16:48549758-48549780 GGGCAGAGGGATGGGGGGCTTGG - Intronic
1137494281 16:48957775-48957797 GGGAGGTGGGATGGGTGGGTGGG - Intergenic
1137693130 16:50442855-50442877 GGGGGGGGGGGTGGGGGGGTGGG + Intergenic
1137783056 16:51114042-51114064 AGGGGGCAGGATGGGGGTGGGGG + Intergenic
1138117206 16:54370239-54370261 GAGGGGCGGGAGGGGGGTGAGGG - Intergenic
1138293413 16:55867313-55867335 GGGCAGCAGCATGGGGGTGTGGG - Intronic
1138851991 16:60640759-60640781 GGGCTGGGGGATGGGGGTGGGGG + Intergenic
1139355859 16:66366782-66366804 GGGTGGCGGGTTTGGGGTGGAGG - Intronic
1139375056 16:66491643-66491665 GGGTGGAGGGATGGGGGCGGGGG + Intronic
1139750448 16:69106462-69106484 GGGAGGCGGGTTGGGGGCGGCGG + Intronic
1140067653 16:71625265-71625287 GGGTGGCTGGATGGGTGAGTGGG + Intergenic
1140223800 16:73063384-73063406 GACCGGGGCGATGGGGGTGTCGG - Intergenic
1140253730 16:73317274-73317296 GGGGGGTGGGGTGGGGGTGGCGG + Intergenic
1140336611 16:74112777-74112799 GGGAGGGGGGAAGGGGGTGAGGG + Intergenic
1140473350 16:75226854-75226876 TGGCCGGGGGATGGGGGTGCTGG - Intergenic
1140865071 16:79052966-79052988 GGGGGTTGGGATGGGGGGGTGGG + Intronic
1140870517 16:79102058-79102080 GGGAGGGGGGGAGGGGGTGTGGG + Intronic
1141132332 16:81444893-81444915 GGGCGCCGGGGTGGGGGCGGCGG - Intergenic
1141683356 16:85556575-85556597 CGGCGGCGCGATGGGGGCGGCGG - Intergenic
1141690959 16:85595935-85595957 GGGCGGAGGAATGGGTGGGTGGG - Intergenic
1141856123 16:86682656-86682678 GGGCGGCTGGATGGGTGTTCCGG - Intergenic
1142057848 16:88011198-88011220 GTGCCCCGGGATGGAGGTGTCGG + Intronic
1142098570 16:88259333-88259355 GGGCAGAGGGATGGGGGCGCGGG - Intergenic
1142132356 16:88436877-88436899 GGGCGGCGGCGCGGGCGTGTGGG - Exonic
1142161870 16:88561984-88562006 GGGATGGGGGATGGGGGGGTGGG - Intergenic
1142161884 16:88562006-88562028 GGGTGGGGGGGTGGGGGGGTGGG - Intergenic
1142216784 16:88834004-88834026 GGGTGGGGGGAGGGTGGTGTTGG - Intronic
1142267421 16:89070942-89070964 GGGCGGCGGCGGGGGGGTGAGGG - Intergenic
1142434587 16:90048031-90048053 GGACGGCGGGACGGGGGGATGGG + Intergenic
1142656772 17:1399793-1399815 GGGCGACGGGGTGGAGGAGTTGG - Intronic
1142665767 17:1462914-1462936 GGGCGGCGCGCTGTGGGTGGAGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1142801874 17:2351368-2351390 GGGCGGCGGCATTGAGGAGTTGG + Intronic
1143116601 17:4584895-4584917 GGGCGGGGGGCTGGGCGTGCCGG - Exonic
1143471613 17:7179145-7179167 GGGAGGCTGGCTGGGGGTGCAGG - Intronic
1143585554 17:7848665-7848687 GGGCTGGGGGGTGGGGGTGGTGG - Exonic
1143648515 17:8248080-8248102 GGGGGTGGGGATGGGGGTGGGGG + Intronic
1144447123 17:15341537-15341559 GAGGGGCGGGAAGGGGCTGTGGG + Exonic
1144800321 17:17921745-17921767 TGGGGGCGGGGTGGGGGGGTGGG + Intronic
1144842203 17:18194145-18194167 GGGCGGGGGGCAGGGGGTGGGGG + Intronic
1145298782 17:21614645-21614667 GGGGGCCGGGAAGGGGGAGTAGG + Intergenic
1145351498 17:22088645-22088667 GGGGGCCGGGAAGGGGGAGTAGG - Intergenic
1145816439 17:27798362-27798384 TGGCGGAGGGGTGGGGGTGGAGG - Intronic
1146095903 17:29930085-29930107 GGGGTGCGGGGTGGGGGTGAAGG + Exonic
1146215972 17:30979529-30979551 GGGAGGCGGGGGGGGGGGGTCGG - Intronic
1146358787 17:32157802-32157824 GGGCGGCGGGGTGGGAGCGGGGG - Intronic
1146444131 17:32922200-32922222 GGGAGGCGGGGGGGGGGGGTCGG - Intergenic
1146646423 17:34579966-34579988 GGGCGGCGGGGAGGAGGCGTCGG + Intergenic
1146790059 17:35745973-35745995 GGGCAGCCGGATGGGGATCTTGG + Exonic
1146936757 17:36816834-36816856 GCGGGGCGGGGTGGGGGGGTAGG - Intergenic
1147153743 17:38532920-38532942 GGAAGGCGGGAAGGGGGTGCAGG + Exonic
1147156037 17:38544879-38544901 GGGCGGAGGGGTAGGGGTGGGGG + Intronic
1147587313 17:41659911-41659933 GGACAGCGGGTTGGGGGCGTTGG - Intergenic
1147890412 17:43712835-43712857 TGGGGGCGGGATAGGGGTGCAGG - Intergenic
1147909576 17:43847383-43847405 GCGGGGCGGGCTGGGGGTGGGGG + Intronic
1147953435 17:44119641-44119663 GGGAGACTTGATGGGGGTGTTGG - Intronic
1148330708 17:46812323-46812345 GGGCGGGGGTAGGGGGGTGGAGG - Intronic
1148664225 17:49362324-49362346 GGGCGGGCGGAGGGAGGTGTCGG - Intronic
1148700612 17:49584533-49584555 GAGAGGGGGGATGGGGATGTGGG + Intergenic
1148735485 17:49862650-49862672 GGGCGGCGGGATGGGCCAGAGGG - Intergenic
1148878545 17:50707658-50707680 GGGCGGGGGCCTGGGGCTGTGGG - Exonic
1149451244 17:56751706-56751728 GGGGTGCAGGGTGGGGGTGTTGG - Intergenic
1149459167 17:56813207-56813229 GGCTGGCGGGTTGGGGGTGGGGG - Intronic
1149772252 17:59331489-59331511 GGGCCGAGGGGTGGGGGAGTGGG + Intergenic
1149845664 17:60008226-60008248 GGTCGTGGGGCTGGGGGTGTTGG + Intergenic
1150084012 17:62264806-62264828 GGTCGTGGGGCTGGGGGTGTTGG + Intergenic
1150273682 17:63882487-63882509 GGGCGTGGGGATGGGGGTGGGGG + Intergenic
1150495803 17:65607071-65607093 GGGTTGTGGGATGGTGGTGTTGG + Intronic
1150640329 17:66945367-66945389 GGGGGGTGGGATGGGGGTGGAGG + Intergenic
1150675800 17:67245245-67245267 CGGCGGCGGGAGGCGGGAGTCGG - Intronic
1150840434 17:68601197-68601219 GGGCGGCGCGAGTGGGGAGTTGG + Exonic
1151013809 17:70531202-70531224 GGGTGGAGGGTTGGGGGTGGAGG + Intergenic
1151381581 17:73729452-73729474 TGGCAGGGGCATGGGGGTGTAGG + Intergenic
1151694207 17:75705739-75705761 GGGCGGTGGGCGGGGGGTGCCGG + Intronic
1151957518 17:77387885-77387907 GGGGGGCGGGAAGGGGGAGGTGG - Intronic
1152024562 17:77800298-77800320 GGGCGGGGGGTGGGGGGTGGTGG + Intergenic
1152088077 17:78232261-78232283 GGGCGGGGTTAAGGGGGTGTCGG - Intronic
1152185634 17:78854918-78854940 GGGCGGGGGGGGGGGGGTGGGGG + Exonic
1152185638 17:78854924-78854946 GGGGGGGGGGGTGGGGGGGTGGG + Exonic
1152193839 17:78904580-78904602 GGGCGGGGGTAGGGGGGTGGTGG - Intronic
1152197281 17:78925147-78925169 CGGCGGCGGGCTGGGGGCGCGGG + Exonic
1152253818 17:79225932-79225954 GGGAAGCAGGATGGGGGTGTGGG + Intronic
1152301078 17:79495561-79495583 GGGGGCAGGGATGGGGATGTGGG + Intronic
1152321020 17:79608943-79608965 CGCCGGCGGGGTGGGGGCGTGGG - Intergenic
1152584091 17:81181444-81181466 GGGCGGGGACATGGGGGTGCAGG + Intergenic
1152593172 17:81223403-81223425 GTGCGGCGGCCTGGGGGTGTCGG - Intergenic
1152623981 17:81380001-81380023 GAGCGGAGGGGTGTGGGTGTGGG - Intergenic
1152626464 17:81390098-81390120 GGGAGCCAGGTTGGGGGTGTGGG - Intergenic
1152729041 17:81960980-81961002 GGGTGCCGGGCCGGGGGTGTCGG + Exonic
1152760141 17:82103453-82103475 GGGAGTGGGGATGGGGGCGTTGG - Intronic
1153130802 18:1853713-1853735 GGGGGAGGGGATGGGGGAGTGGG + Intergenic
1153245056 18:3065550-3065572 GGGTGGCGGGGTGGGGGTGGGGG - Intergenic
1153301287 18:3594335-3594357 GGAGGGAGGGAGGGGGGTGTGGG - Intronic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1154216606 18:12420646-12420668 GGGGCGCGGGGTGGGGGTGGCGG + Intronic
1154359341 18:13645886-13645908 AGGGGTTGGGATGGGGGTGTGGG + Exonic
1154370824 18:13761838-13761860 GGCCGGGGGGAGGGGGGTGTAGG - Exonic
1155193760 18:23453647-23453669 GGGTGCCGGGATGGGGATGGAGG + Intronic
1155356643 18:24960120-24960142 GGGCGGGGGGGTGGGGGGGGTGG - Intergenic
1155519653 18:26656319-26656341 GGGAGGCGGGGAGGGGGTGGGGG - Intronic
1156156369 18:34307437-34307459 GGGCAGTGGGTTTGGGGTGTTGG + Intergenic
1156490229 18:37491707-37491729 GGGCAGCGGGAGGGTGCTGTCGG + Intronic
1157040772 18:44036561-44036583 GGGATGGGGGATGGGGGAGTAGG - Intergenic
1157297737 18:46458163-46458185 GGGTGTCGGGATGGGGGTGCTGG + Exonic
1157489374 18:48111584-48111606 GGTCGGCAGGAGGGAGGTGTGGG + Intronic
1157849965 18:51039486-51039508 GGGTGGGGGGGTGGGGGGGTGGG - Intronic
1158654858 18:59321523-59321545 GGGGGTCGGGGTGGGGGTGGGGG - Intergenic
1159917572 18:74200237-74200259 GGGCGGGGGGCTGGGAGTGTGGG + Intergenic
1160204717 18:76822912-76822934 GGGAGGCGGGAGGCGGGTGAGGG + Intronic
1160570094 18:79810167-79810189 AGGCGGTGGGAGGGGGGAGTGGG + Intergenic
1160680104 19:408493-408515 TGCCGGCGGGGTGGGGGTGGAGG + Intronic
1160818052 19:1045247-1045269 GGGCGGGGGGATGAGGGACTGGG + Intronic
1160926649 19:1549843-1549865 GGATGGGGGGATGGGGGAGTGGG - Intergenic
1161080189 19:2306746-2306768 GGGCGGTGGGATGGGGGCTTAGG - Intronic
1161109573 19:2461932-2461954 GGGCAGCGCGATGGGGTTGGGGG - Intergenic
1161236662 19:3201641-3201663 GGGCAGGGGGATGGGGGTGCGGG + Intronic
1161262512 19:3345637-3345659 GGGCGGCGGGAGGGGGGGGCGGG - Intergenic
1161319460 19:3634260-3634282 AGGAGGCGGGACGGAGGTGTTGG - Intronic
1161348539 19:3779622-3779644 GGGCGGTGGGGTGGGCGTGAGGG + Intronic
1161401228 19:4066950-4066972 GGGGGGCGGGCTGGGCGTGGGGG - Intergenic
1161476888 19:4491250-4491272 GGGTGGGGGGGTGGGGGGGTGGG - Intronic
1161476894 19:4491258-4491280 GGGTGGGGGGGTGGGGGGGTGGG - Intronic
1161612493 19:5250941-5250963 GGGCGGCGGGGGGGGGGGGGGGG + Intronic
1161613399 19:5256736-5256758 GGGGGAGGGGATGGGGATGTGGG - Intronic
1162022678 19:7874765-7874787 GAGCGGCCGGATTGGTGTGTGGG - Intergenic
1162644155 19:12036199-12036221 CGGCGGTGGGCTGGGGGGGTGGG + Intronic
1162790597 19:13060751-13060773 GGTCAGGGGGATGGGGGGGTCGG + Intronic
1162799720 19:13103805-13103827 GGGCGGGGGGGGGGGGGGGTTGG - Intergenic
1162818183 19:13208511-13208533 GGGCGGCGGGGAGGGGGCGGCGG + Intronic
1162850834 19:13429996-13430018 GGGAGGGGGGAAGGGGGAGTCGG + Intronic
1162888262 19:13712740-13712762 GGGGGGCGGGGTGGTGGTGATGG - Intergenic
1162915568 19:13872905-13872927 GGGAGGCGGGAGGGGGGCTTCGG + Intronic
1162955028 19:14092700-14092722 GTTGGGTGGGATGGGGGTGTGGG + Exonic
1163314970 19:16535539-16535561 GGCCGGCGGGATGGGCGCGGCGG + Exonic
1163489167 19:17606803-17606825 GAGGGGTGGGCTGGGGGTGTGGG - Intronic
1163510632 19:17733166-17733188 GGGCGGGGGGATGGGGAGGCAGG - Intronic
1163520276 19:17787913-17787935 GTGGGGAGGGATTGGGGTGTGGG + Intronic
1163547323 19:17948103-17948125 GGGCGGGGGGCGGGGGGTGTCGG - Intergenic
1163577161 19:18117785-18117807 GGGCGGCGGGGGCGGGGCGTTGG - Intronic
1163675535 19:18653743-18653765 GGGCGGATGGATGGGTGGGTGGG - Intronic
1163681955 19:18687858-18687880 GGGCGGAGGGGTGGGTGTGTGGG + Intronic
1163807776 19:19410335-19410357 GGGGTGGGGGATGGGGGTGGTGG + Intronic
1163861397 19:19744775-19744797 GGGCGGCAGGATGAGGGGCTCGG + Intergenic
1164120561 19:22261763-22261785 GGCGGGCGGGGCGGGGGTGTCGG + Intergenic
1164647453 19:29870171-29870193 GGGCCGGGGGGTGGGGGTGGGGG - Intergenic
1164732773 19:30518854-30518876 GGGCAGAGGGATGGGGGTGCAGG + Intronic
1165040233 19:33063796-33063818 GGGCGGCGGGTGGCGGGTGCCGG - Intronic
1165040235 19:33063803-33063825 GGGCGGCGGGCGGCGGGTGGCGG - Intronic
1165061410 19:33206944-33206966 GGGCGGGGGGATGCGGCTGAGGG - Intronic
1165095560 19:33407935-33407957 GGGTGGCTGGCTGGGGGTGAGGG + Intronic
1165156548 19:33792330-33792352 GGGCGGGGGGGTGGGGGTTGGGG - Intergenic
1165309725 19:35022823-35022845 GTGAGGAGGGCTGGGGGTGTCGG + Intronic
1165634810 19:37331799-37331821 GGGTGTCGGGCTGGGGGTGTCGG - Intronic
1165685642 19:37817558-37817580 GGGCTGCGGGCTGGGGCTGTAGG - Intergenic
1165774952 19:38398995-38399017 GGGCGGAGGGATTGGGGGCTGGG + Intergenic
1165788756 19:38478212-38478234 GGGAGTCAGGATGGGGGTGGGGG - Intronic
1166162603 19:40965433-40965455 GGGAGGCGGGGGGGGGGGGTCGG - Intergenic
1166367433 19:42284547-42284569 GGGCGGCCGGAGGGGGGCGGCGG + Intronic
1166627998 19:44378186-44378208 GGGCGGGGGGAGGGGGGAGGGGG + Intronic
1166676044 19:44741815-44741837 GGGTGGGTGGATGGGGGTCTGGG - Intergenic
1166688566 19:44809863-44809885 GGGCTGGGGGGTGGGGGTGGGGG + Intronic
1166765764 19:45251543-45251565 GGGCGGCCGGGTGGGGGGGGCGG - Exonic
1167040839 19:47021583-47021605 GGGCGGCGCGGAGGAGGTGTCGG - Intronic
1167175193 19:47860289-47860311 GGCGGGCGGGGTGGGGGTGGGGG - Intergenic
1167243244 19:48357933-48357955 GGGGGTTGGGATGGGGGTGAGGG + Intronic
1167577801 19:50326069-50326091 GGGCGGGGGCAGGGGGCTGTAGG + Intronic
1167622928 19:50568806-50568828 GGGCGGGGGGCAGGGGGAGTGGG + Intergenic
1167706263 19:51082937-51082959 GGGCGGCGGGAGGTGGGGGCAGG - Intronic
1167738673 19:51311699-51311721 GGGCGGGGGGAGGGGGCTGGGGG - Intergenic
1168240981 19:55088808-55088830 GGGGGGCGGGGTGGGGGTGGGGG - Intergenic
1168241687 19:55092053-55092075 GAGCGAGGGGATGGGGCTGTGGG - Intronic
1168290594 19:55355199-55355221 GGGCGGGGGGAGGGGGGCGAGGG - Intronic
1168370632 19:55831107-55831129 GGGCGGGGGGGTGGGGGGGATGG - Intronic
1168627451 19:57930620-57930642 GGGCAAGGGGGTGGGGGTGTGGG - Intronic
924993296 2:334466-334488 GGGTGGGGGGATGGGGGAGGGGG + Intergenic
926109105 2:10170790-10170812 GGGCGGGGGCGTGGGGGTGCGGG - Intronic
926172188 2:10559341-10559363 GGGCAGCAGGATGGGGGTGTGGG - Intergenic
926422953 2:12716880-12716902 GGGCGGCGGGGGGGGGGCGGAGG + Exonic
926720543 2:15957155-15957177 GGGGGGCGGGGTGGGGGTAGGGG - Intergenic
926907476 2:17819513-17819535 GGGTGGCGGGAGGGGTGGGTAGG - Intergenic
927244581 2:20947197-20947219 GGGTGGTGGGATGGAGGGGTTGG + Intergenic
927633433 2:24793648-24793670 GGGCCGCGGGATGGGCGCGGGGG + Intronic
927794132 2:26033781-26033803 GGGAGGCGGGAGGCGGGGGTCGG + Intergenic
927843773 2:26461073-26461095 GTGGGGCGGGGTGGGGGTGGGGG + Intronic
927921510 2:26975591-26975613 GGGAGGTGGGATTTGGGTGTGGG + Intronic
927983505 2:27390813-27390835 GTGCGGCAGGGTGGGGGTGGGGG - Intronic
928016944 2:27666361-27666383 GGGGGGCGGGGTGGGGGGGGGGG - Intronic
928088093 2:28358290-28358312 GGTCGGCGGGGCGGGGGAGTAGG - Intergenic
928145437 2:28770382-28770404 GGGGGGGGGGAGGGGGGTGTGGG + Intronic
928193408 2:29194651-29194673 GGGTGGGGGGGTGGGGGGGTGGG - Intronic
928303569 2:30147465-30147487 GCGCGGCGGGTTGGGGGTCGCGG - Intronic
928606409 2:32947824-32947846 GGGCGGGCGGAAGGGGGTGTGGG - Intronic
928682060 2:33712727-33712749 TGGCGGGGGGGTGGGGGGGTTGG + Intergenic
928983289 2:37157183-37157205 GGGGCGGGGGATGGGGGTGCAGG - Intergenic
929211882 2:39366266-39366288 GGGTGGTGGGGTGGGGGTGGAGG + Intronic
929606665 2:43239352-43239374 GGGGCGGGGGATGGGGGTGGAGG - Intronic
929673767 2:43903573-43903595 GGGGGGTGGGGTGGGGGTGGGGG + Intronic
930236025 2:48889650-48889672 GGGCGGGGGGATGTGGGAGTGGG + Intergenic
930852498 2:55975596-55975618 GGGTGGGGGGGTGGGGGGGTGGG + Intergenic
931029454 2:58155755-58155777 GGGCGGCGGGGTGGGGGGGATGG - Intronic
931235106 2:60406390-60406412 GGGCTGAGGGATTGGTGTGTGGG - Intergenic
932222581 2:70011107-70011129 GGGTGGAGGGTGGGGGGTGTGGG + Intergenic
932817530 2:74873976-74873998 TGGCCAAGGGATGGGGGTGTGGG + Intronic
932834369 2:75021732-75021754 AGGCTGTGGCATGGGGGTGTTGG + Intergenic
933728178 2:85437973-85437995 GGGCGGGGGGCTGGGGGCGGGGG + Intergenic
933772308 2:85752427-85752449 GGGAGGTGGGATGGGGATCTGGG - Intronic
933909839 2:86930127-86930149 TAGCGGCAGGAGGGGGGTGTGGG + Intronic
934022888 2:87973261-87973283 TAGCGGCAGGAGGGGGGTGTGGG - Intergenic
934116938 2:88807603-88807625 GGGAGGCAGGATGGGGCAGTGGG - Intergenic
935111222 2:100096073-100096095 GGTTGGGGGGATGGGAGTGTTGG - Intronic
935301712 2:101698312-101698334 GCGCGGCGGGCTCGGGGCGTGGG - Intronic
937963602 2:127483580-127483602 GGGTGGTGGGGTGGGGGGGTTGG + Intronic
937977380 2:127589854-127589876 GGGCGGGTGGATGGGTGGGTGGG + Intronic
938469478 2:131545318-131545340 GGGGGCCGGGAAGGGGGAGTAGG + Intergenic
938537099 2:132256304-132256326 GGGTGGTGGGAGGGGGGTGGTGG + Intronic
939520155 2:143220292-143220314 GGGTGGATGGATGGGGGTGGAGG - Intronic
939564151 2:143766811-143766833 TGGCGGCGGGATGGGGTTTCTGG + Intronic
939992356 2:148887799-148887821 GGAGGGCGGGAAGGGGGCGTAGG - Intronic
940453708 2:153871769-153871791 GGGAGGAGGGCTGGGGGTGCTGG + Intergenic
940646043 2:156393983-156394005 CGGGGGCGGGAAGGGGGTGGGGG + Intergenic
941917825 2:170823656-170823678 TGGCGGCAGGGTGGGGGTGGAGG - Intronic
941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG + Intronic
942116730 2:172735769-172735791 GGGGGGCGGGACGCGGGTGCGGG - Intronic
942240986 2:173964273-173964295 GGGCGGGGGGAGGGGAGTGGAGG + Intronic
942311810 2:174663465-174663487 GGGCGGCGGGGTGGGGGGAAGGG - Intronic
942458271 2:176152257-176152279 GGGGGTGGGGATGGGGGGGTGGG + Intronic
942589984 2:177533378-177533400 GGGTGGGGGGATGGTGGGGTGGG - Intronic
943639431 2:190343153-190343175 GGTGGGCGGGGTGGGGGTGGGGG - Intronic
943954972 2:194176628-194176650 GGGTGGGGGGGTGGGGGTGTTGG - Intergenic
944897356 2:204178436-204178458 GAGCTGGGGGATGGGGGTGGAGG - Intergenic
944917775 2:204378454-204378476 GAGCCGCGGGTTGGGGGTATGGG - Intergenic
945648814 2:212536298-212536320 GTGCGGCAGGGTGGGGGTGGGGG + Intronic
945981572 2:216316555-216316577 GGGGGGCGGGAGAGGGGTGCGGG + Intronic
946363801 2:219236100-219236122 GGGGTGCGGGATGAGGGAGTGGG + Intronic
946843117 2:223837342-223837364 GCGCGGCCGGGTGGGGGTGCGGG - Intronic
947423358 2:229960488-229960510 GGGCGGGGGGGCGGTGGTGTTGG + Intronic
947526274 2:230878448-230878470 GGGCAAGGGGATGGGGCTGTGGG + Exonic
947794166 2:232883888-232883910 GGCCTGGGGGTTGGGGGTGTCGG - Intronic
947796439 2:232896676-232896698 GGGGGTAGGGATGGGGGTGGGGG + Intronic
948144646 2:235699234-235699256 GGTCAGGGGGATGGGGGTCTAGG + Intronic
948494737 2:238340048-238340070 GGGTGGCGGGGCGGGGGGGTTGG + Intronic
948738238 2:240025166-240025188 GGGTGGCGGGGTGGCGGGGTGGG - Intronic
948765376 2:240216643-240216665 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765427 2:240216750-240216772 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765451 2:240216802-240216824 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765496 2:240216906-240216928 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948788338 2:240364691-240364713 GGGTGGCTGAAGGGGGGTGTGGG - Intergenic
948871960 2:240805126-240805148 GGGCGGAGGGAGAGGGGAGTGGG + Intronic
948922355 2:241071696-241071718 GGGGGGCTGGGTGGGGGTCTCGG - Exonic
948953752 2:241272230-241272252 TGGCGGCGGGGCGGGGGTCTGGG - Intronic
1168756766 20:324168-324190 GGGGGGCGGGGTGGGGGTGGTGG - Intergenic
1169085243 20:2822073-2822095 GGGCGGGGGGGTGGGGGGGTGGG + Intergenic
1170890072 20:20368828-20368850 GGGCGGCGGCAGGGGGCAGTGGG - Exonic
1171174178 20:23038855-23038877 TGGTGGCGGGGTGGGGGTGTAGG + Intergenic
1171561797 20:26133930-26133952 GGGGGCCGGGACGGGGGAGTAGG - Intergenic
1171767876 20:29300266-29300288 GGGCGGTGGGAGGGGGGCGGTGG + Intergenic
1171866012 20:30488083-30488105 GGGTGGTGGGAGGGGGGTGGTGG + Intergenic
1171875412 20:30570630-30570652 GGGTGTGGGGATGGGGGTGGGGG + Intergenic
1172064133 20:32207496-32207518 GGGCCCCGGGTCGGGGGTGTGGG + Intronic
1172838168 20:37886327-37886349 GGGAGGCGGGATGGAGATGCTGG + Intergenic
1173352471 20:42257638-42257660 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
1173485570 20:43438581-43438603 AGGCTGCTGGGTGGGGGTGTGGG - Intergenic
1173663580 20:44750618-44750640 GGGGCGCGGGCTGGGGGTGCGGG - Exonic
1173686079 20:44924317-44924339 GGGTGGAGGGGTGGGGTTGTGGG - Intronic
1173737755 20:45373767-45373789 GGGCCTCGGGGTGGGGGTGGGGG + Exonic
1173846402 20:46191415-46191437 GGGCGTGGGGATGGGGATGGGGG + Intronic
1173907450 20:46639212-46639234 GGGCAGGGGGGTGGGGGTGAGGG + Intronic
1174335159 20:49854509-49854531 GGAAGGTGGGGTGGGGGTGTGGG - Intronic
1174362770 20:50039069-50039091 GGGGGGTGGGATGAGGGAGTGGG + Intergenic
1174362779 20:50039089-50039111 GGGGGGTGGGATGAGGGAGTGGG + Intergenic
1174558448 20:51412977-51412999 GGGCGGCGGGAGCGGGGGATGGG - Intronic
1175050020 20:56146671-56146693 GGGGGGAGGGGTGGGGGTGGAGG - Intergenic
1175210464 20:57350895-57350917 GGGCGGGGGGACGGGGGCGGGGG + Intergenic
1175223572 20:57431978-57432000 GGGCAGCGGGTCGGGGGTGGGGG + Intergenic
1175360621 20:58408892-58408914 GGGGGGCGGGGTGGGGGGGGGGG - Intronic
1175490584 20:59378291-59378313 GGGTAGCGGGCTGGGGGTGGAGG + Intergenic
1175736088 20:61388271-61388293 GGGTGGGGGTAGGGGGGTGTGGG + Intronic
1175803917 20:61816840-61816862 GGGCAGGGGGATGGGGATGCGGG - Intronic
1175901165 20:62360419-62360441 GGGTGGAGGGATGGGTGAGTGGG + Intronic
1176005800 20:62861716-62861738 GGGCGGCGGGAGGCGGGAGGCGG + Exonic
1176038045 20:63049901-63049923 GGGCGGAGGGGAGGGGGTGGAGG - Intergenic
1176232174 20:64038257-64038279 GGAAGGCGGGGTGGGGGTGGGGG - Intronic
1176247861 20:64105732-64105754 GGTGGGCCTGATGGGGGTGTGGG + Intergenic
1176380903 21:6111601-6111623 GGGCGGCGGGGGCAGGGTGTGGG + Intronic
1176569460 21:8402089-8402111 GGGCGTGGTGGTGGGGGTGTGGG + Intergenic
1176649512 21:9531704-9531726 GGGGGCCGGGAAGGGGGAGTAGG + Intergenic
1177012489 21:15745122-15745144 GGTCGGGGGGAGGGAGGTGTGGG + Intronic
1177532216 21:22374734-22374756 GCGCGGGAGGAGGGGGGTGTCGG + Intergenic
1177775721 21:25563577-25563599 CGGATGTGGGATGGGGGTGTCGG + Intergenic
1177792449 21:25735392-25735414 GGGAGGCGGGAGGGGGGTTGGGG + Intronic
1178437974 21:32576015-32576037 GGGTGGAGGGCTGGGGGTGTTGG + Intergenic
1178510619 21:33202210-33202232 GGGCATCGGGAAAGGGGTGTGGG - Intergenic
1178615574 21:34130109-34130131 GGGTGGGGGGATGGGGGAGGGGG - Intronic
1178865190 21:36320725-36320747 GGGCGGGGGGACGGGGCTGCGGG + Intronic
1179105388 21:38395924-38395946 AGGCAGCGGGGTGGCGGTGTGGG - Intronic
1179209369 21:39312982-39313004 GGGCGGCGGGCGGGGGGCGCGGG + Intronic
1179371189 21:40807455-40807477 GTGGGGCGGGATGGGGGTGGAGG + Intronic
1179466820 21:41581421-41581443 GGGCGGCGGGCGGGGTGTGGAGG - Intergenic
1179484930 21:41704110-41704132 GGGCGGGGGCATGGTGGGGTGGG - Intergenic
1179518818 21:41928691-41928713 GAGCTGCGGGATTGGGGGGTGGG - Intronic
1179603326 21:42495882-42495904 GGGAGGCAGGATGGGGGTGGGGG + Intronic
1179718108 21:43300462-43300484 TGGAGGGGGGCTGGGGGTGTCGG - Intergenic
1179742569 21:43426639-43426661 GGGCGGCGGGGGCAGGGTGTGGG - Intronic
1179810187 21:43865186-43865208 GGGCGGCGGGATGGGGGCCGGGG + Intronic
1179836051 21:44034320-44034342 GGGGGGGGGGTTGGGGGAGTGGG - Intronic
1180064854 21:45407076-45407098 GGGCTGGGGGAGGGGTGTGTGGG - Intronic
1180081890 21:45490885-45490907 GGGCGGGTGGATGGGGATGGGGG + Intronic
1180129582 21:45819002-45819024 GGGCGGAGAGATGGATGTGTAGG + Intronic
1180312721 22:11252957-11252979 GGGTGGTGGGAGGGGGGTGGTGG + Intergenic
1180927876 22:19568552-19568574 GGGCTGGGGGATGGTGGGGTGGG + Intergenic
1180965742 22:19787208-19787230 AGGCCTGGGGATGGGGGTGTTGG - Exonic
1180967312 22:19797341-19797363 GGGAGGGGGGGTGGGGGTGCAGG + Intronic
1181532338 22:23523944-23523966 TGGGGGTGGGATGGGGGTGGCGG - Intergenic
1181586447 22:23855351-23855373 GGGAGGCGGGGTGGGGGGGGGGG + Intergenic
1182024678 22:27108863-27108885 TGGGGGCGGGGGGGGGGTGTCGG - Intergenic
1182243157 22:28933707-28933729 GGGGGGTGGGGTGGGGGTGGGGG - Intronic
1182391621 22:30001978-30002000 GGGCAGGGGGTTGGTGGTGTTGG + Intronic
1182427738 22:30283788-30283810 GGGAGGGGGGTTGGGGGAGTAGG - Intergenic
1183090706 22:35520012-35520034 GGGGCGCTGCATGGGGGTGTCGG - Intergenic
1183154955 22:36067663-36067685 GGGGGGTGGGGTGAGGGTGTAGG - Intergenic
1183354193 22:37349638-37349660 GGGTGGTGGGGTGGGGGTGCAGG + Intergenic
1183382854 22:37499069-37499091 GGGTGGCGGGAGCGGGGTGGGGG - Intronic
1183409854 22:37648441-37648463 GGGCCGCGGGCTGGGGGAGGTGG + Intronic
1183427113 22:37746040-37746062 GGACGGCGGGACGGCGGGGTGGG - Intronic
1183517146 22:38273106-38273128 GGGCGGCGGGCTGGGGTTCGGGG - Intergenic
1183517155 22:38273126-38273148 GGGCGGCGGGCTGGGGTTCGGGG - Intergenic
1183671681 22:39276551-39276573 GGGGGGCGGGGTGTGGGTGATGG - Intergenic
1183720180 22:39557888-39557910 GGGCGGCGGGCGGGGGGCGGCGG - Intergenic
1184034514 22:41912129-41912151 GGGTGACGGAATGGGGATGTTGG + Intronic
1184059739 22:42074536-42074558 GAGAGGCGGGCTGGGGGTGCGGG - Intronic
1184226642 22:43132610-43132632 GGGGGGCAGGCTGGGGGTGGTGG + Exonic
1184265440 22:43343540-43343562 GGGCGGCAGGTGGGGGGTGTGGG + Intergenic
1184408694 22:44314190-44314212 GGGCGGTGGGGCGGGGGTGGGGG + Intergenic
1184473730 22:44710008-44710030 GGGCGGCGGGTAGGGGGTCAGGG - Intronic
1184547722 22:45183082-45183104 GGGCGGGGGGGGGGGGGGGTTGG + Intronic
1184649470 22:45913062-45913084 TGGAGGGGAGATGGGGGTGTGGG - Intergenic
1184799928 22:46753039-46753061 GGGCCTGGGGATGGGGGTGGGGG - Intergenic
1185026137 22:48414406-48414428 GGGCGGGGGGTGGGGGGTGCTGG - Intergenic
1185110181 22:48896338-48896360 GGGCGGAGGGCAGGGGGTGATGG + Intergenic
1185272464 22:49935537-49935559 GGGCAGGGGGATGAGGGTCTGGG + Intergenic
1185320343 22:50197766-50197788 GGGCAACGGGCTGGGGGGGTGGG - Intronic
950522803 3:13506602-13506624 GGGGGGTGGGGTGGGGGTGGGGG + Intergenic
950532177 3:13558656-13558678 GGGTGGATGGATGGGTGTGTGGG - Intronic
950534157 3:13569689-13569711 GGTCTGCGGGCTGGGGCTGTAGG + Intronic
950536344 3:13581205-13581227 GGGCGGCAGGTGGGGGGTGGGGG + Intronic
950683988 3:14603214-14603236 CGGGGGCGGGATGGCGGTGGGGG + Intergenic
950722183 3:14891297-14891319 GGGCGGCTGGATGGAGGTGGTGG - Intronic
950896444 3:16455954-16455976 GGGCGGTGGGAGGGAGGTGTCGG - Intronic
951611698 3:24496891-24496913 GGGGGGCGGGAGGGGGTTGGGGG + Intergenic
952241187 3:31532828-31532850 GGCCGGCGGACTGGGGGTGGAGG - Exonic
952747221 3:36792640-36792662 GGCTGGCGGGGTGGGGGTGGTGG - Intergenic
952767752 3:36969690-36969712 GGGCGGGGGGGGGGGGGTGGAGG + Intergenic
952899429 3:38099769-38099791 CGGGGGCGGGGTGGGGGTGGGGG + Intronic
953002660 3:38950058-38950080 GGGGGGGGGGGTGGGGGTGGGGG - Intronic
953013100 3:39047033-39047055 GGGTGGGGGGATGGGGGTGGGGG - Intergenic
953246766 3:41199951-41199973 GGCAGGCGGGGTGGGGGTGGGGG + Intronic
953340521 3:42130705-42130727 GGGAGGAGGGAGGGGGGTCTGGG + Intronic
953357354 3:42266224-42266246 GCGAGGCGGGGTGGGGGGGTTGG + Intergenic
953414596 3:42708518-42708540 TGGAGCCGGGATGGGGGTGAGGG + Exonic
953449184 3:42991988-42992010 GGGCAGAGGGGTGGGGGTGGGGG - Intronic
953614417 3:44477553-44477575 GGGCGCGGGGGTGGGGGTGGCGG - Intronic
953908841 3:46882063-46882085 CGGCGGCGGGATGTGAGTGCTGG - Intronic
953974388 3:47371384-47371406 CGGCGGCGGGGTGGGGGTGGGGG - Intergenic
954083208 3:48224465-48224487 AGGCTGGGGGCTGGGGGTGTTGG + Intronic
954119844 3:48491061-48491083 GGGCGGGGGGTTGGGAGGGTGGG - Intronic
954315405 3:49798780-49798802 GGGTGACAGGATGGGGGTGGGGG - Intronic
954431468 3:50473005-50473027 GGGCCACGGGTTGGGGGAGTTGG + Intronic
954558379 3:51536034-51536056 GGGCCAGGGGATGGGGGTGGGGG + Intergenic
955531686 3:59879914-59879936 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
955554243 3:60118768-60118790 GGGCGGCGGGGGGGGGGGGGTGG + Intronic
955699787 3:61671874-61671896 GGGCGGCTGGATGGGCGGGGGGG + Intronic
956144908 3:66182710-66182732 GGGCGGCGGGGGGGGGGGGTGGG + Intronic
956379975 3:68654880-68654902 GGGCGGGGGGGTGGGGGGGGAGG + Intergenic
956420906 3:69085499-69085521 GGGCGGGGGCAGGGGGGTGGGGG - Intronic
956507578 3:69959015-69959037 AGGGGGTGGGATGGGGGTGAGGG + Intronic
957196282 3:77072364-77072386 GGGCGGCAGGAGGAGGGTTTGGG - Intronic
958878017 3:99637969-99637991 GGGCGGTGGGACGGGGCTGAGGG + Intergenic
959092224 3:101915941-101915963 GGGTGGAGGAAAGGGGGTGTAGG - Intergenic
959415150 3:106073611-106073633 GGGAGGCGGGGGGGGGGTGTCGG - Intergenic
959560059 3:107769004-107769026 GGGCGGCGGGGGGGGGGAGCCGG + Intronic
960223901 3:115147608-115147630 CGGCGGGGGGAGGGGGTTGTGGG - Intergenic
960535283 3:118808751-118808773 GCGGGGCGGGGTGGGGGTGGGGG - Intergenic
960590897 3:119364225-119364247 GGGTGGGGGGATGGAGGTGGGGG + Intronic
961594565 3:128006518-128006540 GGGCGGGGGGAAGGGGGTGGTGG - Intergenic
961616178 3:128182880-128182902 GGGCGGGGGGGTGGGGTGGTTGG + Intronic
962742613 3:138372935-138372957 GTGGTGGGGGATGGGGGTGTGGG + Exonic
964665993 3:159172767-159172789 GGGCGGGGGGGTGGGGGTGGGGG + Intronic
964726268 3:159817306-159817328 GGGTGGCGGGCTGCGGGTGGCGG + Intronic
966168941 3:177055543-177055565 GGGGGGCGGGGCGGGGGTGGGGG + Intronic
966925568 3:184642603-184642625 GGGTTGGGGGATGGGGGTGTGGG + Intronic
967099051 3:186200926-186200948 GGGCAGCTGGAAGGGGGTGTTGG + Intronic
967330946 3:188288820-188288842 GGGCGGGGGGGTGGGGGTGGGGG - Intronic
967493323 3:190117746-190117768 GGGCTGGGGGAGGGGGGTGAAGG + Intronic
967863355 3:194170154-194170176 AGGCGGAGGGATGGGGGTTTGGG + Intergenic
968064513 3:195751139-195751161 GGGTGGGGGGCTGGGGGTGGGGG + Intronic
968450027 4:671209-671231 GGGCTGCAGGAAGGGGGTGCTGG + Intergenic
968518383 4:1024216-1024238 GGGTGGTGGGCTGGGGGTGCTGG + Intronic
968887162 4:3341182-3341204 GGGTGGAGAGATGGGGGTGTGGG + Intronic
968887186 4:3341254-3341276 GGGTGGAGAGATGGGGGTATGGG + Intronic
968887213 4:3341319-3341341 GGGTGGAGAGATGGGGGTATGGG + Intronic
968887292 4:3341518-3341540 GGGTGGAGAGATGGGGGTGTGGG + Intronic
968887306 4:3341549-3341571 GGGTGGAGAGATGGGGGTGTGGG + Intronic
968887317 4:3341581-3341603 GGGTGGAGAGATGAGGGTGTGGG + Intronic
968887341 4:3341642-3341664 GGGTGGAGAGATGGGGGTGTGGG + Intronic
968887353 4:3341665-3341687 GGGAGGGGAGATGGGGGTGTGGG + Intronic
968887365 4:3341694-3341716 GGGTGGAGAGATGGGGGTGTGGG + Intronic
968887376 4:3341726-3341748 GGGTGGAGAGATGAGGGTGTGGG + Intronic
968927286 4:3556276-3556298 GGGCGGGGGGAGGGAGATGTGGG - Intergenic
968928081 4:3560519-3560541 GGGTGGGTGGATGGGTGTGTGGG - Intergenic
969115385 4:4867631-4867653 GGGCCGCGGGAGGGCGCTGTGGG - Intergenic
969477068 4:7427832-7427854 GGGCGGGGGGGCGGTGGTGTGGG - Intronic
969583134 4:8076994-8077016 GGGCTGCAGGATGGGGGTTGGGG + Intronic
969583148 4:8077036-8077058 GGGCTGCAGGATGGGGGTTGGGG + Intronic
969589001 4:8110651-8110673 GGGTGGCGGGGGTGGGGTGTGGG + Intronic
969675517 4:8612187-8612209 GGGCGGGGGGTGGGGGGTGCAGG + Intronic
971303212 4:25458802-25458824 GGAGGGTGGGATGGGGGTGAGGG - Intergenic
971490991 4:27211837-27211859 GAGCGGCGGGGTGGGGGGGGTGG + Intergenic
971966430 4:33562968-33562990 GGTGGGCGGGAAGGGGGTGGTGG - Intergenic
972072329 4:35038082-35038104 GGGTGGCGGGATGCGGGGGATGG - Intergenic
972427212 4:38944812-38944834 GGGTAGCGGGATGGGGGTGGGGG - Exonic
972492223 4:39598840-39598862 GGGGCGGTGGATGGGGGTGTGGG - Intronic
973655663 4:53044894-53044916 GGGGGGGGGGTTGGGGGTGGAGG - Intronic
973899596 4:55454851-55454873 TGGCGGCGGGGTTGGGGGGTGGG - Intronic
974002990 4:56530012-56530034 GGGCGGGGGGCGGGGGGTGTGGG - Intergenic
974548959 4:63348638-63348660 GGCTGGGGGGATGGGGGTGGGGG + Intergenic
976220965 4:82756653-82756675 GGACGGGGGGAGGGGGGTGGGGG - Intronic
976284219 4:83355633-83355655 GGGGGGCGGGGTGGGAGTGGTGG + Intergenic
977323331 4:95547382-95547404 GGGGGTGGGGATGGGGGTGTTGG - Intronic
977471763 4:97452117-97452139 GGGCGGGGGGGGGGGGGGGTGGG - Intronic
977884949 4:102243873-102243895 GGGCGACTGGAAAGGGGTGTTGG - Intergenic
978361027 4:107931519-107931541 CGGGGGCGGGCAGGGGGTGTAGG - Exonic
979114105 4:116799248-116799270 TGGATGCGGGGTGGGGGTGTAGG - Intergenic
979278073 4:118835740-118835762 GGCCGGCGGGATGGGGGAGCAGG - Intronic
981329080 4:143487843-143487865 GGGTGGCGGAAGGGTGGTGTTGG - Intergenic
981745641 4:148049844-148049866 GGGCGGGGGGCGGGGGGTGGTGG + Intronic
981938221 4:150256181-150256203 GGGCAGCGGGAGGAGGGTGGGGG - Exonic
982157651 4:152536954-152536976 GGGCGGCGGGAAGGGAGGATTGG + Intergenic
982236970 4:153260679-153260701 GGGGGGGGGGGTGGGTGTGTGGG - Intronic
983828210 4:172291719-172291741 GGGCAGGGGGAGGGGGGTGGCGG - Intronic
984999715 4:185471358-185471380 GGGCGGAGGGATGGGGCGGAGGG + Intronic
985058982 4:186057859-186057881 GGGTGGCGGGAGGTGGGTGGCGG - Intergenic
985451999 4:190067657-190067679 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985452984 4:190070954-190070976 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985453973 4:190074247-190074269 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985454961 4:190077540-190077562 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985455950 4:190080840-190080862 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985456933 4:190084134-190084156 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985457920 4:190087427-190087449 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985458909 4:190090727-190090749 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985463161 4:190173492-190173514 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985489819 5:172578-172600 GGGGGCCGGGGTGGGGGTGTGGG + Intronic
985560648 5:584335-584357 GGGTGGCTGGATAGGTGTGTGGG + Intergenic
985678484 5:1244188-1244210 GGGCAGTGGGAAAGGGGTGTGGG - Intronic
985782072 5:1876652-1876674 GGGCGGAGGGCTCGGGGTGGGGG + Intergenic
985796490 5:1966079-1966101 GGGCAGGGGGATGGGGGAGCTGG + Intergenic
985896302 5:2751576-2751598 CGGCGGCGGGGTGGCGGTGGCGG + Exonic
986143204 5:5050860-5050882 GGGCCTCTGGATGGGGGTGTGGG + Intergenic
986338904 5:6773947-6773969 GAGCGGCGGGGTGTGTGTGTGGG - Intergenic
986338932 5:6774029-6774051 GAGCGGCGGGGTGTGTGTGTGGG - Intergenic
986721486 5:10563993-10564015 GGCCCGCGGGATGGGGGCGGAGG - Intergenic
989380874 5:40808367-40808389 AGGGGGCGGGTTGGGGGTGGTGG + Intergenic
989600042 5:43192439-43192461 GGGTGGCGGGGTGGGGGTGCTGG - Intronic
992549139 5:77844915-77844937 GGACGGCGGGAGGGGGTTGGGGG - Intronic
992716119 5:79513570-79513592 GGGGGGCGGGAAGGGGCTGAGGG - Exonic
992939744 5:81750765-81750787 GGGCGGCCGCAGGGGGCTGTCGG - Intronic
993839970 5:92865887-92865909 GGGCGGCGGGAGTGGGGGGAAGG + Intergenic
995786961 5:115841069-115841091 GGGCGGGGGGAGGGGGGTCTCGG - Intronic
996097214 5:119411628-119411650 GGGCGGGGGGTAGGGGGTGGGGG - Intergenic
996680980 5:126227952-126227974 GAGCGGCTGGAAAGGGGTGTTGG - Intergenic
996795563 5:127342968-127342990 GTTGGGCGGGGTGGGGGTGTGGG - Intronic
997315497 5:132931181-132931203 GGGCAGGAGGATGGGGGAGTGGG + Intronic
997367408 5:133334875-133334897 AGGAGGCTGGGTGGGGGTGTGGG + Intronic
997387964 5:133488752-133488774 GGGAGTGGGTATGGGGGTGTTGG + Intronic
998165219 5:139838822-139838844 GGGCTGCTGGATGGGGGCCTGGG - Intronic
998183421 5:139961345-139961367 GGGGGCAGGGATGGGGGTGAGGG - Intronic
998402732 5:141856308-141856330 GAGGGGCGGGGTGGGGGTGGAGG + Intronic
998797455 5:145835239-145835261 GCGCGCGGGGATGGGGGTCTCGG - Exonic
998823583 5:146078964-146078986 GGGAGTCGGGCTGGGGGTGATGG - Exonic
999651654 5:153774054-153774076 GGGAGGGGGGGTTGGGGTGTAGG - Intronic
1000205184 5:159051434-159051456 GGGCGGCGGGGTGGGGGGGTGGG - Intronic
1000987465 5:167876281-167876303 GGGCTGGGGGAAGGTGGTGTGGG + Intronic
1001392312 5:171388593-171388615 TGGGGGAGGGAGGGGGGTGTGGG + Intronic
1001503773 5:172260053-172260075 GTGCGGCGGGGAGGGGGTGGGGG - Intronic
1001892308 5:175349872-175349894 GTGCTGCGGGCTGGGGCTGTTGG - Intergenic
1001917488 5:175574018-175574040 GGGATGTGGGATGAGGGTGTCGG - Intergenic
1001980453 5:176034421-176034443 GGGGGCCGGGAAGGGGGAGTAGG - Intronic
1002099008 5:176848185-176848207 GGGCGGAGGGATCTGGGTGCGGG - Intronic
1002206930 5:177569298-177569320 GGGCAGCGGGGTGGGGTGGTGGG + Intergenic
1002237008 5:177809644-177809666 GGGGGCCGGGAAGGGGGAGTAGG + Intergenic
1002642168 5:180635484-180635506 GGGTGGTGGGATGGAAGTGTGGG + Intronic
1002888789 6:1317027-1317049 GGGAGGCGGGAGGAGGGGGTGGG - Intergenic
1003028122 6:2576684-2576706 GGGCGGTGGGGTGGGGGTTGGGG + Intergenic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003207596 6:4027589-4027611 TGGCGGAGGGGTGGGGGGGTGGG + Intronic
1003291267 6:4780393-4780415 GGGCGGGGGGGGGGGGGCGTAGG - Intronic
1004818394 6:19337425-19337447 GGGTGGGGGGGTGGGGGTGTGGG + Intergenic
1006023617 6:31132993-31133015 TGGGGGCGGGCTGGGGGAGTGGG + Intronic
1006030029 6:31171595-31171617 GGGTGGGGGGATGGGGGGGTGGG - Intronic
1006124856 6:31830927-31830949 GGGCTGTGGGATGGGGGAATGGG + Intergenic
1006170124 6:32087619-32087641 GGGTGGCGGGGCGGGGGTGCGGG + Intronic
1006272191 6:32972968-32972990 GGGCGGCGGCACAGGGGTGTGGG + Intronic
1006614073 6:35312775-35312797 GAGGGGCAGGATGGGGGTGGAGG + Intronic
1006654258 6:35576681-35576703 GGGGGGCGGGCGGGGGGAGTTGG + Intronic
1006860582 6:37169760-37169782 GGGAGGCGGGAGCTGGGTGTAGG - Intergenic
1007110496 6:39310855-39310877 GGCCAGGGGGATGGGGGTGGGGG - Intronic
1007111130 6:39314035-39314057 GCGCGGCGGGATGGGGTAGCGGG - Intronic
1007656832 6:43455627-43455649 GGGGGGGGGGATGGGGGTGGGGG - Intronic
1008058189 6:46967106-46967128 GGGCGGGGGGGGGGGGGGGTGGG + Intergenic
1009994119 6:70880076-70880098 GGGCGTGGGGGTGGGGGTGGGGG + Intronic
1011508694 6:88076532-88076554 GGGGTGTGGGATGGGGCTGTAGG + Intergenic
1011704351 6:89985958-89985980 GGCTGGAGGGATGCGGGTGTGGG + Intronic
1015935500 6:138403637-138403659 GGCCGGCGGAAAGGGGGTGCTGG + Intronic
1016330036 6:142945773-142945795 GGGAGGCGGGCTGGAGGTGAGGG - Intergenic
1016386847 6:143537313-143537335 TGGCGGCGGGGTGGGGGTGGGGG + Intronic
1017101721 6:150854899-150854921 GAGCGGCTGGAAAGGGGTGTTGG - Intergenic
1017156332 6:151325609-151325631 GGGTGGCTGGGTGGGGGCGTGGG + Intronic
1017732006 6:157324888-157324910 GGGGGGCGGGATGGGGTGGATGG - Intergenic
1018240312 6:161767763-161767785 GGGTGGGGGGCTGGGGGTGTGGG + Intronic
1018254520 6:161904747-161904769 GGGACTGGGGATGGGGGTGTGGG + Intronic
1018371016 6:163168402-163168424 GGGTTGCGGGTTGGGGGTGGGGG + Intronic
1018435083 6:163752113-163752135 GGGCGGCGCGTTGGGAGTGCAGG - Intergenic
1018496541 6:164352903-164352925 TGAAGGCGGGATAGGGGTGTAGG - Intergenic
1018757496 6:166862759-166862781 GCGCGGCGGGCTGGGGAGGTGGG - Intronic
1018795036 6:167179296-167179318 GGGTGGAGGGCTAGGGGTGTCGG - Intronic
1018821282 6:167375766-167375788 GGGTGGAGGGCTAGGGGTGTCGG + Intronic
1019427621 7:984819-984841 GGGAGTGGGGATGGGGGTGAGGG + Intronic
1019472868 7:1230375-1230397 GGGGGGCGGGGTGGGGGGGTGGG + Intergenic
1020096817 7:5374176-5374198 GGGCGGCGGGCTGGTGGGGTGGG + Exonic
1020428434 7:8095250-8095272 GGGCTGGGGGGTGGGGGGGTTGG + Intergenic
1020513487 7:9088824-9088846 GGGTGGAGGGTTGGGGGAGTGGG + Intergenic
1021537669 7:21723735-21723757 GGGTGGAGGGGTGGGGGAGTGGG - Intronic
1021761227 7:23904762-23904784 GGGCGGGGGGATTGGGGTGTTGG + Intergenic
1021798720 7:24284003-24284025 GGGCGGGAGGGTTGGGGTGTGGG + Intergenic
1021859640 7:24893737-24893759 GGGCGGCGGGGCGGGGGGGACGG + Intronic
1022094246 7:27129263-27129285 GGGGGTGGGGATGGAGGTGTGGG + Exonic
1022099645 7:27161523-27161545 TGGCGGCGGGGTGGGGGTGGGGG + Intergenic
1022771048 7:33473318-33473340 GGGCGGGGGGGTGAGGGGGTGGG - Intronic
1022988818 7:35686811-35686833 GGGGGGGGGGGTGGGGGGGTGGG + Intronic
1023319246 7:38975873-38975895 GGGCTGGGGGCTGGGGGTGTGGG - Intergenic
1023337445 7:39185202-39185224 GGGTGGCGGGATGGGGGAGGGGG + Intronic
1023743723 7:43303089-43303111 GGGCAGGGGGCTGTGGGTGTGGG - Intronic
1023843583 7:44109373-44109395 GGGCCACAGGATGGGGGTGCTGG + Intronic
1024312135 7:47979328-47979350 TGGGGCCGGGATGGGGGTGCTGG - Intronic
1025173952 7:56787487-56787509 GGGAGGCGGTCCGGGGGTGTGGG - Intergenic
1025698148 7:63790467-63790489 GGGAGGCGGGCCGGGGGTGTGGG + Intergenic
1025829870 7:65038938-65038960 GGGAGGCGGGCCGGGGGTGTGGG + Intergenic
1025852934 7:65258420-65258442 GGGAGGCGGGGGGGGGGGGTCGG + Intergenic
1025917123 7:65873938-65873960 GGGAGGCGGGCCGGGGGTGTGGG + Intronic
1026038576 7:66847012-66847034 GGGGGGCGGGGAGGGGGTGAAGG - Intergenic
1026348279 7:69493844-69493866 GGGCGGGGGGGTAGGGGAGTTGG + Intergenic
1026821568 7:73553115-73553137 GGGTGGTGGGGTGGGGGTGGGGG + Intronic
1026890429 7:73978716-73978738 GGGGGGCGGGGTGGGGATGGGGG - Intergenic
1026894131 7:74000283-74000305 GGGCGGCGGGTGGGGGGGGGCGG + Intergenic
1026984440 7:74546094-74546116 GGGCGGAGGGATGAGGGTGAGGG - Intronic
1027400253 7:77799068-77799090 GGTCGTCGGGATGGAGGTGGGGG + Intronic
1027803094 7:82781311-82781333 GGGGGGCTGGAGGGGGTTGTTGG - Intronic
1028086852 7:86645981-86646003 GGGCGGGGGGGTGGGGGTGGGGG + Intronic
1028485561 7:91353658-91353680 TGGCGGCGGGGTGGGGGAGGTGG + Intergenic
1028773728 7:94656249-94656271 GGGATGGGGGATGGGGGTGGGGG - Intergenic
1029123136 7:98281577-98281599 GGGCGGCGGGAGGCGGGGCTCGG - Intronic
1029755783 7:102572745-102572767 GGGGTGCGGGGTGGGGGGGTGGG - Intronic
1030014597 7:105206143-105206165 GGGTGGTGGGGTGGGGGTGGGGG - Intronic
1031361826 7:120857365-120857387 GGGCGGCGGGGCGGGGGCGGGGG + Intronic
1031629728 7:124032550-124032572 GGGCGGCGGGGCGGGGGTCGCGG - Exonic
1032013802 7:128363293-128363315 GGGCGGCGGGGGGCGGGTGCTGG + Intergenic
1032074507 7:128830208-128830230 GGGCGGCGGGACGGGGTTGAGGG - Intergenic
1032151307 7:129432610-129432632 GGGCGGGGGGCTGGGTGTGGGGG - Intergenic
1032855199 7:135828221-135828243 GGGCAGCCGGATGATGGTGTGGG + Intergenic
1033388114 7:140899200-140899222 GGGCTGAGGGGTGGGGGGGTGGG - Intronic
1034441066 7:151086367-151086389 GGGCGGCGGGGAGGGGGGCTCGG + Intronic
1034444413 7:151105760-151105782 GGGGGGCGGAATGGAGGGGTTGG - Intronic
1034620272 7:152451645-152451667 GGGGGGGGGGTTGGGGGGGTGGG - Intergenic
1034994827 7:155571015-155571037 GGGTGGTGGGATGGGGATGAGGG - Intergenic
1035300071 7:157891404-157891426 GGGTGGGGGGCGGGGGGTGTGGG - Intronic
1035414439 7:158671081-158671103 GGGCAGGGGGGTGGGGGTGGGGG + Intronic
1035414462 7:158671163-158671185 GGGCAGGGGGGTGGGGGTGGGGG + Intronic
1035520747 8:273750-273772 GGGGTGGGGGAAGGGGGTGTGGG + Intergenic
1035671003 8:1417083-1417105 GGGTGGGGGGATGGGGGGGTGGG + Intergenic
1035717031 8:1763291-1763313 GGGCGGCGGCATGGGGGCGGTGG - Intronic
1036200941 8:6771232-6771254 GGGGGACGGGATGGGGTTGAGGG + Intergenic
1036392551 8:8336896-8336918 GGGAGGGGGGAAAGGGGTGTGGG - Intronic
1036561546 8:9903768-9903790 GGGTGGAGGGATGGGGGTGTGGG + Intergenic
1036659754 8:10700368-10700390 GGGGGGCGGGATAGGGGTGGGGG - Exonic
1036709081 8:11066887-11066909 GTGCTGGGGGATGGGAGTGTGGG - Intronic
1037731606 8:21529807-21529829 GTGTGGCGGGGTGGGGCTGTGGG - Intergenic
1039060126 8:33566457-33566479 TGGCGGCGGGCCGGGGGCGTGGG - Intronic
1040342359 8:46447406-46447428 GGGCGGCAGGGTGGCTGTGTGGG - Intergenic
1041355115 8:56992685-56992707 GGGAGTCGGGGTGGGGGGGTGGG - Intronic
1042050188 8:64695381-64695403 GGGCGGCGGGCTGAGGGAGAAGG + Intronic
1043052974 8:75405140-75405162 GGGTGGGGGGATGGGGGTGGGGG + Intergenic
1043463857 8:80486552-80486574 GCGCGGCGGGGCGGGGGTGGAGG + Exonic
1045818924 8:106311994-106312016 GGGCAGGGGGGTGGGGGTGTAGG - Intronic
1046757745 8:117989241-117989263 AGGCAGTGGGATGGGGGTGGGGG - Intronic
1047224874 8:122947808-122947830 GGGCGGCGGGAGAGGGGAGCCGG + Intronic
1047361324 8:124172002-124172024 GGGCGGCGGGGGGGGGGGGGGGG + Intergenic
1047747167 8:127853923-127853945 GGGCCACGGGATGGGGGCGGGGG - Intergenic
1047916811 8:129592241-129592263 AGGGGGCGGGGTGGGGGTGGGGG - Intergenic
1047962980 8:130024472-130024494 GGGGGGCGGGGTGGTGGTGGGGG - Intergenic
1048293090 8:133195518-133195540 GGGTGGGGAGTTGGGGGTGTGGG - Intronic
1048295883 8:133212960-133212982 GGGCAGCGGGGTGGGGATGGCGG - Exonic
1048956454 8:139541131-139541153 AGGTGGCAGGATGGGGGTCTTGG - Intergenic
1049103604 8:140597469-140597491 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
1049154665 8:141059401-141059423 TGGGGGCGGGCTGGGGGTGGAGG + Intergenic
1049222444 8:141434225-141434247 GGGCTGGGGAATGGGGGTGGTGG - Intergenic
1049265773 8:141667108-141667130 GGGAGGCAGGATGGGAGTGGGGG + Intergenic
1049271916 8:141700543-141700565 GAGAGGCGGGATGGGGGAGGGGG + Intergenic
1049359951 8:142207643-142207665 GGGTGGATGGATGGGGGTATGGG + Intergenic
1049554912 8:143276989-143277011 CCGCTGCGGGATGGGGGTGATGG + Intergenic
1049575107 8:143386288-143386310 GTGCGGTGGGAGGGGGGTGCTGG - Intergenic
1049657641 8:143805789-143805811 GGGTGTTGGGGTGGGGGTGTGGG - Intronic
1049879307 8:145051619-145051641 GGGTGGCGGTATGGGGGAGAGGG - Intergenic
1050018836 9:1262999-1263021 GGGAGGAGGGATGGGGGTATTGG + Intergenic
1051079573 9:13279264-13279286 GGGGGCGGGGATGGGGGTGGGGG - Intronic
1051151903 9:14089269-14089291 GGGTTGGGGGTTGGGGGTGTTGG + Intronic
1051406041 9:16738808-16738830 GGGCGGGAGGATGGGGGTGGGGG - Intronic
1051894728 9:21975185-21975207 GGGAGGCCGGAGGGCGGTGTGGG - Intronic
1053313857 9:37035895-37035917 GGGCTGGGGGCGGGGGGTGTTGG + Intergenic
1053802210 9:41771686-41771708 GGGCGGGGGGAGGGAGATGTGGG - Intergenic
1053802945 9:41775616-41775638 GGGCGGGTGGATGGGTGGGTGGG - Intergenic
1054191243 9:61986946-61986968 GGGCGGGTGGATGGGTGGGTGGG - Intergenic
1054489413 9:65762585-65762607 CGGCGGCGGGGGGGGGGTGGGGG - Intergenic
1054647126 9:67600771-67600793 GGGCGGGTGGATGGGTGGGTGGG + Intergenic
1054647875 9:67604745-67604767 GGGCGGGGGGAGGGAGATGTGGG + Intergenic
1055010115 9:71556084-71556106 GGGCAGGGGGGTGGGGGTGGTGG - Intergenic
1055059398 9:72053150-72053172 GGGCGGCAGGGTGGGGTTGGAGG + Intronic
1055689645 9:78815931-78815953 GGGGGGGGGGGTGGGGGGGTGGG - Intergenic
1056139414 9:83660662-83660684 GGGGGACGGGGTGGGGGGGTGGG - Exonic
1056587314 9:87937371-87937393 GGGGGCCGGGAAGGGGGAGTAGG - Intergenic
1056965353 9:91160164-91160186 GCGCCGCGGGGTGGGGGTGGGGG - Intergenic
1057040602 9:91844881-91844903 GGGCGGGGGGAAGGGGGTGCGGG + Intronic
1057117725 9:92541428-92541450 GGGTGGGGGTGTGGGGGTGTGGG - Intronic
1057239138 9:93392918-93392940 TGGCAGGGGGATGGGGGTGGGGG - Intergenic
1057307447 9:93920503-93920525 GGGTGTCGGGATGGAGGTCTGGG + Intergenic
1057489228 9:95508733-95508755 GGGGGGCGGGTAGGGGGAGTTGG - Intronic
1057704954 9:97389582-97389604 GGCAGGCGGGGTGGGGGTGGGGG - Intergenic
1057757783 9:97851923-97851945 GGGGGGCGGGCCGGGGCTGTGGG - Intergenic
1057801208 9:98192501-98192523 GGTCTGCGCGATGGGGGCGTCGG - Intronic
1057988684 9:99744661-99744683 GGGTGGTGGGATGGGGCTGGGGG - Intergenic
1058784619 9:108374895-108374917 GGGTGGAGGGGTGGGGGTGAGGG - Intergenic
1059107672 9:111525408-111525430 CCGCTGCGGGATGGGGCTGTTGG + Intronic
1059115755 9:111599201-111599223 GGGCGGCGGGAGGCGAGGGTGGG - Intronic
1060148139 9:121268969-121268991 AGGCTGGGGGCTGGGGGTGTGGG + Intronic
1060192199 9:121600096-121600118 GGGCGGCGGGAGTTGGGGGTGGG + Intronic
1060376655 9:123120479-123120501 GGGCGGGGGGGTGGGGGGGGGGG + Intronic
1060614147 9:124996203-124996225 GGGCGGTGGGGCGGGGGTGGGGG + Intronic
1060855801 9:126914566-126914588 GGGCGGCGGGCCGGGTGTGCTGG + Intergenic
1060912060 9:127359088-127359110 GGGCGGCGGGTGGGGGGAGTGGG - Intronic
1060967511 9:127720205-127720227 GGGCGGCAGGAAGTGGGTGCTGG - Intronic
1061085791 9:128397435-128397457 GGGAGGGGGGATGGGGGGATAGG + Intergenic
1061726418 9:132584477-132584499 TGGGGGTGGGGTGGGGGTGTTGG - Intronic
1061947262 9:133915255-133915277 GGAGGGCGGGACGGTGGTGTGGG - Intronic
1061954706 9:133955600-133955622 GGGGGGAGGAGTGGGGGTGTGGG - Intronic
1062345822 9:136114728-136114750 GGGAGGCGGGAGGGGGCTGGTGG - Exonic
1062431370 9:136528223-136528245 GAGCAGAGGGGTGGGGGTGTGGG + Intronic
1062474811 9:136721736-136721758 TGGCTGCAGGATGGGGCTGTCGG - Intronic
1062556214 9:137114417-137114439 GGGCGGCGGGACGGCGGGGGCGG + Intronic
1062577475 9:137215377-137215399 GGACGGCGGGGTGGGGGTGGTGG - Intronic
1062656213 9:137605578-137605600 GAGGGGCCGGATGGGGGTGGAGG + Intergenic
1203795341 EBV:171778-171800 TGGCGGGGGCATGGGGGGGTCGG + Intergenic
1203471825 Un_GL000220v1:118526-118548 GGGCGTGGTGGTGGGGGTGTGGG + Intergenic
1203361222 Un_KI270442v1:220436-220458 GTGCGGTGGGAGGGGGGTGGTGG + Intergenic
1203627253 Un_KI270750v1:35252-35274 GGGGGCCGGGAAGGGGGAGTAGG + Intergenic
1185458588 X:323016-323038 TGACGGTGGGGTGGGGGTGTGGG + Intergenic
1185459718 X:328674-328696 GGGAGGGGGGATGGGGGGGCGGG - Intergenic
1185735877 X:2495766-2495788 GTGCGGGGGGAGGGGGGTTTGGG + Intronic
1186508917 X:10116085-10116107 GGGTGGCTGGATGGGTGGGTGGG - Intronic
1186652816 X:11579032-11579054 GGGTGGGGGGATGGGGGGATGGG + Intronic
1186802803 X:13110599-13110621 GGGCGGAGGGGCGGGGGTGGGGG - Intergenic
1187290405 X:17947990-17948012 TGGCAGCAGGATTGGGGTGTGGG + Intergenic
1187405655 X:19001321-19001343 GGGCGGTGGCATGGGGCTGGCGG - Intronic
1187507183 X:19887376-19887398 GGGCGCCGGGATCGGGGCGCTGG + Exonic
1187937178 X:24347328-24347350 CGGAGGCGGGGTGGGGGTGGGGG - Intergenic
1187993941 X:24905415-24905437 GGGTGGGGGGGTGGGGGTGGGGG + Intronic
1188008451 X:25034495-25034517 GGGGGGCGGGTGGGGGGTGGGGG + Intergenic
1188069048 X:25696196-25696218 GGGCGGGGGGGTGGGGGGGGGGG + Intergenic
1188246413 X:27840776-27840798 GGGTGCAGGGATGGGGGGGTTGG - Intergenic
1189330947 X:40144973-40144995 GGGCGGGGGGAGGGGGGTTGAGG - Intronic
1189821884 X:44876618-44876640 GGCCGGGGGGTTGGGGGTGGGGG - Intronic
1189954559 X:46263978-46264000 GGGTGGCGAGATGCGGGGGTGGG - Intergenic
1190243591 X:48676536-48676558 GGCCGGGGGGGAGGGGGTGTGGG - Intergenic
1190267382 X:48835486-48835508 GGGCCGCGGGCCGGGGGCGTCGG - Exonic
1192057321 X:67785949-67785971 GGGGGGAGGGGCGGGGGTGTTGG + Intergenic
1192354124 X:70383887-70383909 GGGTGGGGTGATGGGGTTGTAGG + Intronic
1193221771 X:78934980-78935002 GGGCTGCGGGAGGGGGTTGGGGG + Intergenic
1193969963 X:88039127-88039149 GGGCGGGGGGCGGGGGGTGGGGG - Intergenic
1194426854 X:93749171-93749193 GGGAGGCCGGGGGGGGGTGTGGG + Intergenic
1194977815 X:100410919-100410941 GGGTGGAAGGATGGGGGTGACGG - Intergenic
1195068465 X:101258169-101258191 GGGGGTGGGGATGGGGGTGGGGG + Intronic
1195158093 X:102142555-102142577 GGTGGGCGGGAAGGGGGTGGTGG - Intronic
1196147936 X:112340593-112340615 GGGAGGCGGGGTGGCGGGGTAGG + Intergenic
1196507430 X:116463732-116463754 GGGCGGCGGGATCGGTGGGGAGG - Intergenic
1196804649 X:119573970-119573992 GGGGGGCGGGGCGGGGCTGTGGG - Intergenic
1197721927 X:129751093-129751115 GGGGGGGGGGGTGGGGGAGTGGG - Intronic
1197935637 X:131737322-131737344 GGGCGGGGGGAGGGGGGCGGTGG + Intergenic
1197980717 X:132216525-132216547 GGGCGGCGGGAGGGGGTGTTGGG + Intronic
1198870888 X:141176518-141176540 GGGCTGCGGGGAGGGGGTGGCGG + Exonic
1200017696 X:153179171-153179193 GGGCGTGGGGGTGGGGGTGGGGG - Intergenic
1200108989 X:153729489-153729511 GGGCGGCGGGCTGGCTGAGTTGG - Intronic
1200256665 X:154586042-154586064 GGGGGGAGGGGTGGGGGAGTGGG + Intronic
1200261104 X:154618361-154618383 GGGGGGAGGGGTGGGGGAGTGGG - Intronic
1200487545 Y:3787037-3787059 GGGCGGGGGGGTGGGGGGGGAGG + Intergenic
1200829106 Y:7673363-7673385 GGGCAGCGGGGCCGGGGTGTGGG - Intergenic
1201077224 Y:10197124-10197146 GGGCGGTGGGAGGGGGGTGGTGG - Intergenic
1201140463 Y:11023276-11023298 GGGCGGGGGGGTGGGGGGGGAGG - Intergenic
1201768159 Y:17592348-17592370 GGGTGGGGGGGGGGGGGTGTGGG + Intergenic
1201833394 Y:18313637-18313659 GGGTGGGGGGGGGGGGGTGTGGG - Intergenic