ID: 1097107290

View in Genome Browser
Species Human (GRCh38)
Location 12:56633296-56633318
Sequence ATGCCAGGAGTATCTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097107290 Original CRISPR ATGCCAGGAGTATCTGGTGG GGG (reversed) Intronic
903593902 1:24479436-24479458 ATGCCAAGAATATCTGTTAGTGG + Intergenic
904545640 1:31268889-31268911 AGGCCAGGAGTCTCTTGTTGAGG + Intronic
904973269 1:34435512-34435534 TTGTCAGGAGTATCTGAGGGAGG - Intergenic
905984692 1:42268979-42269001 ATGCCAGCAGATTCTGGTGATGG - Intronic
906008949 1:42504568-42504590 ATTTCAGCAGCATCTGGTGGAGG - Intronic
907631364 1:56085510-56085532 AAGGCAGGAGAATCTTGTGGAGG + Intergenic
911354939 1:96804880-96804902 ATGCCTGGAGTCTCAGCTGGTGG + Exonic
913213610 1:116601855-116601877 AGGCCAGGAGCACCTGGTGTGGG - Intronic
913273746 1:117118604-117118626 GTGCCAGGATTGTGTGGTGGGGG - Exonic
914726020 1:150328428-150328450 ATGCCAGGGCTCTCTGATGGAGG - Exonic
917406818 1:174715860-174715882 ATACCAGGAGCATCAGGTGAAGG - Intronic
917926758 1:179795545-179795567 ATGGCACCAGCATCTGGTGGGGG - Intronic
920387210 1:205577446-205577468 ATGCCTGGGGAAGCTGGTGGTGG + Intronic
920415023 1:205793400-205793422 ATGCCAGGGGTCTGTGGTGGAGG - Intronic
921312222 1:213855751-213855773 ATGCCAGGAAAAGCTGGTCGTGG - Intergenic
922686872 1:227646534-227646556 ATGCCAGTAGTCCCTGGGGGGGG - Exonic
923679708 1:236109768-236109790 ATGCCAGGTGTGTCTGGTGCCGG + Intergenic
923893558 1:238242518-238242540 ATGTCAGAAATATGTGGTGGTGG + Intergenic
1067926142 10:50510062-50510084 CTGCCAGGAGCATGTGATGGGGG - Intronic
1069807318 10:71134070-71134092 ATCCCAGGAGGGCCTGGTGGTGG - Intergenic
1070057854 10:72952811-72952833 AAGCCAGCAGCAACTGGTGGGGG - Intronic
1075312276 10:121424534-121424556 CTGCCTGAAATATCTGGTGGCGG + Intergenic
1076104427 10:127809412-127809434 ATGGCACCAGTATCTGGTGAGGG - Intergenic
1076199122 10:128544291-128544313 ATGCTAGGTGTGGCTGGTGGTGG + Intergenic
1076524924 10:131106447-131106469 ATTCCAGGACCAGCTGGTGGTGG + Intronic
1077330950 11:1983578-1983600 CTGCCTGGGGTATCTGGGGGTGG + Intronic
1077488729 11:2850815-2850837 GTGCCAGGAGCATCTGCTGGGGG + Intergenic
1078892631 11:15571048-15571070 ATGGAATGAGTATCTGGTGGGGG - Intergenic
1079185499 11:18232289-18232311 ACCCCAGGAGTATGTGGAGGAGG + Intronic
1082228401 11:49735535-49735557 ATTTCAGCAGCATCTGGTGGAGG - Intergenic
1083091829 11:60207835-60207857 CTGCCAGGAGCATCTGCTGCAGG + Intronic
1083314579 11:61806517-61806539 ATGCAGGGAGTAACTGGGGGTGG + Intronic
1084533680 11:69744574-69744596 ATTCCAGAAGTAGATGGTGGTGG - Intergenic
1088394509 11:109351611-109351633 ATGCAAGGAATATCAGGTGAAGG - Intergenic
1202813930 11_KI270721v1_random:38757-38779 CTGCCTGGGGTATCTGGGGGTGG + Intergenic
1093892958 12:24545723-24545745 CTGCCAGGAGTATCGGCTGCTGG + Intergenic
1096259788 12:50083315-50083337 CTGGAAGGAGTGTCTGGTGGAGG - Exonic
1097107290 12:56633296-56633318 ATGCCAGGAGTATCTGGTGGGGG - Intronic
1102181411 12:110915193-110915215 AGGTCAGGAGTAAGTGGTGGTGG + Intronic
1103904268 12:124319464-124319486 AGCCCAGGGGTTTCTGGTGGGGG - Intergenic
1104466336 12:128993870-128993892 CTCCCAGGAGGATCTGCTGGGGG - Intergenic
1105216844 13:18292412-18292434 AGGCCAGGAGCACCTGGTGTGGG - Intergenic
1106423223 13:29601266-29601288 ATAACAGGAGAAACTGGTGGGGG + Intergenic
1107418735 13:40225494-40225516 ATGCAAGTAGTAGCTGGAGGTGG + Intergenic
1107817520 13:44257220-44257242 ATGAGAGGAGCATCTGCTGGGGG + Intergenic
1113173092 13:107528735-107528757 ATGTCAGGAGTCTCTGATGTAGG + Intronic
1116762956 14:49037746-49037768 ATGCAAGGAGTGTCTGGGGATGG - Intergenic
1117267361 14:54103654-54103676 AATCCAGGATTGTCTGGTGGCGG + Intergenic
1121315542 14:92959107-92959129 CTGACAGGAGGATCTGGTAGGGG + Intronic
1126188583 15:45855229-45855251 ATGCCTAGAGTATCTGGAGCTGG + Intergenic
1126462378 15:48927540-48927562 ATGCCAGGGGTTTCATGTGGTGG - Intronic
1126864502 15:52922429-52922451 GTGTCAGGAGTGTCTGGAGGAGG + Intergenic
1132101855 15:99029312-99029334 ATTACAGGAGACTCTGGTGGTGG - Intergenic
1132115186 15:99130936-99130958 CTGCCAAGAGTACCTGATGGTGG - Exonic
1132301705 15:100780087-100780109 ATGCAAGGGGAATCTGTTGGGGG + Intergenic
1132775331 16:1590526-1590548 AGGCCAGGAGCAGCTTGTGGAGG - Intronic
1135474457 16:22762119-22762141 TTGCCAGGATTATCTGGGGAAGG + Intergenic
1135909612 16:26547165-26547187 ATGCCAGGAGTATCCAGGGCAGG + Intergenic
1136146199 16:28317900-28317922 GTGCCAGGAGTGTCTGGGGAGGG + Intronic
1137728159 16:50670728-50670750 ATGCCAGGAGGAGCTGGCTGTGG + Intronic
1138345772 16:56319377-56319399 ATGACAGGAGAAGCTGGTGCAGG + Intronic
1138350588 16:56344386-56344408 TTGCCTGGGGTCTCTGGTGGAGG + Exonic
1144754961 17:17674085-17674107 ATGGCACCAGCATCTGGTGGGGG + Intergenic
1149917900 17:60628514-60628536 TTGCCAGGAGTAAGTGGGGGAGG - Intronic
1157090567 18:44631860-44631882 ATGGCTGGAGTATCTGGGGAAGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157887182 18:51380118-51380140 ATGAAATGAGAATCTGGTGGTGG + Intergenic
1159049498 18:63406193-63406215 GTGCCAGTAGTTTCAGGTGGTGG + Intronic
1159688753 18:71458497-71458519 ATGACAGCAGTATATAGTGGTGG - Intergenic
1160745236 19:708490-708512 TTTGCCGGAGTATCTGGTGGAGG - Intergenic
1162451874 19:10759862-10759884 TTGCCAGGAGTTGCTGGGGGCGG + Intronic
1162743413 19:12786169-12786191 AGGCCAGGAGTTCCTGGGGGAGG + Intronic
1166201570 19:41240835-41240857 ATGCAAGGAGAATCGGGTGTGGG - Intronic
925751550 2:7094298-7094320 ACACCAGGAGTGTCTGGTGACGG + Intergenic
931388619 2:61819702-61819724 ATGCCAAGAGTGTGTGGTTGAGG - Intergenic
934297480 2:91754273-91754295 AGGCCAGGAGCACCTGGTGTGGG + Intergenic
937919722 2:127120642-127120664 ATGCATGGAGTATCGGCTGGGGG - Intergenic
938669068 2:133569700-133569722 ATGCAATGAGCATCTGCTGGGGG - Intergenic
942732377 2:179074524-179074546 ATGCCAGGTGAAACAGGTGGTGG + Intergenic
944655820 2:201876012-201876034 ATGACAGGAGTATCTTGCAGAGG - Intronic
945860449 2:215115592-215115614 ATGCCAAGAGTATAGGGGGGTGG - Intronic
946138743 2:217669761-217669783 ATGGCACCAGCATCTGGTGGTGG + Intronic
947541381 2:230982142-230982164 GTGGCAGAAGTTTCTGGTGGAGG - Intergenic
947638827 2:231694503-231694525 CTGCCAGAAGGAACTGGTGGAGG - Intergenic
948070333 2:235116253-235116275 ATGACAGCAGCATCAGGTGGGGG - Intergenic
1170645422 20:18193056-18193078 CTGCCAGTAGCAGCTGGTGGAGG + Intergenic
1171126486 20:22606406-22606428 TTGCCTGGAGTTTCTGGTGCTGG + Intergenic
1174400439 20:50273178-50273200 ATGCCAGAGGCATATGGTGGAGG + Intergenic
1176148948 20:63579128-63579150 GTGCCAGAAGGATCTGATGGGGG + Intergenic
1178366459 21:31992618-31992640 AAGCCAGGAGTCTCTGCAGGCGG + Intronic
1181046623 22:20217662-20217684 ATGCCACAAGTATCTGTGGGTGG + Intergenic
1181375427 22:22454284-22454306 AAGTTAGGGGTATCTGGTGGAGG - Intergenic
950283036 3:11723169-11723191 ATGCCAGGATTACCTGGGTGGGG + Intergenic
950660154 3:14462106-14462128 CTGCCAGGGGCCTCTGGTGGTGG - Intronic
951770596 3:26252069-26252091 ATGCCCGGAGTTTTTGCTGGTGG - Intergenic
952703160 3:36347957-36347979 ATGCCATGAGTGACTGGTGAGGG - Intergenic
954300897 3:49700226-49700248 GCGCAAGGTGTATCTGGTGGAGG + Exonic
956054289 3:65282000-65282022 AGTCCAGGAGCATCTGGTGAGGG - Intergenic
956196746 3:66660695-66660717 CTGGCAGGGGTATCTGGTGAGGG - Intergenic
967570539 3:191022941-191022963 ATGCCAGAAATATCTTGTGATGG + Intergenic
969397253 4:6930273-6930295 ATGCCTGGAGTAACTGGAGGAGG - Intronic
975562763 4:75723177-75723199 ATGCCCAGAGTATGTGGGGGAGG + Intronic
977310894 4:95385976-95385998 ATGCCAGGAGATACTGGTTGGGG - Intronic
984612469 4:181856632-181856654 ATCCCAGAAGTATCAGCTGGAGG - Intergenic
989027124 5:37080728-37080750 ATGTCTGGAGTATCAGGTGTTGG - Intergenic
990100756 5:52183516-52183538 ATGCAAGGTGTATCTCTTGGTGG - Intergenic
993174151 5:84460700-84460722 ATGACAGCAGCATCTGGTGAGGG + Intergenic
994559243 5:101346648-101346670 ATGGCAGGAGCAGATGGTGGCGG - Intergenic
1002306187 5:178285267-178285289 CTGGCAGGAGACTCTGGTGGTGG - Intronic
1002922841 6:1585437-1585459 AAGCCAGGAGCTTCTGGGGGAGG - Intergenic
1007117056 6:39350203-39350225 CAGGCAGGAGGATCTGGTGGTGG + Intronic
1008179977 6:48316349-48316371 TTGGTAGGAGAATCTGGTGGTGG + Intergenic
1008743893 6:54645042-54645064 ATTCCAGGAGTATCAGCTGTGGG + Intergenic
1008813167 6:55530049-55530071 AAACCTGGAGGATCTGGTGGGGG + Intronic
1010497883 6:76557840-76557862 CTGTAAGGAGTATCTGGTGAAGG - Intergenic
1011968508 6:93191529-93191551 AAGGCAGGAATATATGGTGGAGG + Intergenic
1015688074 6:135889177-135889199 AGGCCTGGGGTATCTGTTGGTGG - Intronic
1017050405 6:150387534-150387556 ATTCAAAGAGTATATGGTGGAGG - Intronic
1019094846 6:169570884-169570906 AGGCCAGGAGTCTCCCGTGGCGG + Intronic
1020727180 7:11831041-11831063 ATGCTTGGAGTTTCTGGCGGGGG - Intronic
1026971834 7:74473232-74473254 ACCCCAGGAGAACCTGGTGGGGG + Intronic
1027970423 7:85073532-85073554 ATACCAGGTGTGTGTGGTGGTGG - Intronic
1034001608 7:147419325-147419347 CTGCCAGGAGGCTTTGGTGGTGG - Intronic
1036009937 8:4710517-4710539 GTGCCAGGAGAAGATGGTGGGGG + Intronic
1046449889 8:114374807-114374829 ATGACAGCAGCCTCTGGTGGGGG - Intergenic
1048951341 8:139499377-139499399 ATGCCAGGGGTATCTGGGCCTGG + Intergenic
1049072149 8:140364568-140364590 ATGCTAAGAGTTACTGGTGGAGG - Intronic
1049847615 8:144810664-144810686 CTGCCAGGAGTCTCAGGTGATGG - Intronic
1053146774 9:35717389-35717411 CTGCCAAGAGCAACTGGTGGAGG - Exonic
1057905069 9:98976858-98976880 ATGCCCAGACTACCTGGTGGGGG + Intronic
1059117278 9:111610932-111610954 ATGCCAGGCGTGACTGATGGAGG - Intergenic
1060247465 9:121958471-121958493 CTGCCAGGAGGAAATGGTGGAGG - Intronic
1060295392 9:122339594-122339616 CTGCCAGGAGAACCTGGGGGAGG - Intergenic
1061476915 9:130873930-130873952 AAGCCAGGAGTATCTGGATCAGG - Intronic
1187988795 X:24846927-24846949 ATCCCAAGAGTGTCTAGTGGAGG - Intronic
1191258659 X:58290978-58291000 AAGCCAGGGGTTTCCGGTGGAGG - Intergenic
1194736719 X:97521179-97521201 GTGCCAGCAGTGTCTGGTGAGGG - Intronic
1197700651 X:129597121-129597143 ATGCCAGGAGAAGCTGGTCAAGG - Intergenic
1199196886 X:145042111-145042133 AAGGCAGGAGGATTTGGTGGGGG - Intergenic
1200081948 X:153581581-153581603 AAGCCCGGAGGAGCTGGTGGTGG + Exonic
1200205319 X:154311355-154311377 CTGCCTGGAGTATATGTTGGAGG + Intronic
1201423296 Y:13822502-13822524 GTGCCACTAGTATCTAGTGGGGG + Intergenic