ID: 1097108485

View in Genome Browser
Species Human (GRCh38)
Location 12:56639979-56640001
Sequence TGGGGTGCAAAAGATCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097108485_1097108492 15 Left 1097108485 12:56639979-56640001 CCTGCAGGATCTTTTGCACCCCA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1097108492 12:56640017-56640039 TGCTCACTGCCAACAATGTTGGG 0: 1
1: 1
2: 1
3: 5
4: 133
1097108485_1097108491 14 Left 1097108485 12:56639979-56640001 CCTGCAGGATCTTTTGCACCCCA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1097108491 12:56640016-56640038 ATGCTCACTGCCAACAATGTTGG 0: 1
1: 1
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097108485 Original CRISPR TGGGGTGCAAAAGATCCTGC AGG (reversed) Exonic
906810948 1:48826454-48826476 TGGGGTGCAAAGGAACCAGGTGG - Intronic
909862309 1:80623154-80623176 TGTGCTGCAAAGGATACTGCTGG - Intergenic
909923243 1:81407364-81407386 TGAGGTTAAAAAGATCCTGTTGG + Intronic
911089496 1:94007195-94007217 TGGGATTCAAGAGCTCCTGCAGG + Intronic
913005681 1:114628822-114628844 TGGGATGAATAAGATCTTGCAGG - Intronic
920597648 1:207288961-207288983 AGAGGTGCAAAAGATGCTGTAGG - Intergenic
922923186 1:229326439-229326461 TGGGGTTCACAAGTTCCTGGGGG - Intronic
1063063953 10:2590149-2590171 TGGGGTGAACAAGAACTTGCAGG - Intergenic
1063954096 10:11249982-11250004 TGAGGTGCAAAACTGCCTGCTGG - Intronic
1067381063 10:45773868-45773890 TGGGATGAAAAACATACTGCAGG + Intronic
1067758529 10:49025552-49025574 TGGGCTGCAACAGATCTAGCTGG + Intronic
1067888760 10:50114506-50114528 TGGGATGAAAAACATACTGCAGG + Intronic
1074978230 10:118597934-118597956 TTGGGTGCATAAAACCCTGCAGG - Intergenic
1075587758 10:123669709-123669731 TATGGTGCCAAACATCCTGCAGG - Intronic
1077367863 11:2168420-2168442 TGGGGTGCAGGGGCTCCTGCAGG - Intronic
1080214718 11:29827519-29827541 GGGGATGCTAAAAATCCTGCAGG - Intergenic
1083288448 11:61676155-61676177 TGGGGTGCTAAAAATCATCCTGG + Intergenic
1083761029 11:64817887-64817909 AGGGGTGCAGGAGAGCCTGCGGG + Intergenic
1090411593 11:126513236-126513258 TTGGGAGCAAAAGATGCTGGGGG + Intronic
1091394202 12:143570-143592 TGGGGTGCCAGAGTTCATGCAGG + Intronic
1091394208 12:143600-143622 TGGGGTGCCAGAGTTCATGCAGG + Intronic
1092982987 12:13816505-13816527 TGGGCTCCAAAAAAGCCTGCTGG - Intronic
1093886078 12:24462938-24462960 TGGGGTGCAGTGGCTCCTGCCGG + Intergenic
1097108485 12:56639979-56640001 TGGGGTGCAAAAGATCCTGCAGG - Exonic
1101574384 12:105983951-105983973 TGGGGGACAAAAGACCTTGCTGG + Intergenic
1111150169 13:84242758-84242780 TGAGGTGCAAAATTTCTTGCTGG + Intergenic
1112929597 13:104717704-104717726 TAGGGTGAAGAAGATGCTGCTGG - Intergenic
1116594021 14:46817257-46817279 TGGGGTGCATTAGATCTTTCAGG + Intergenic
1116597717 14:46872786-46872808 TGTGGGGAAAAAGATCATGCAGG - Intronic
1117953158 14:61102823-61102845 TAGGTTGAAAAAAATCCTGCTGG + Intergenic
1117974587 14:61284480-61284502 TGGGGTGTTAAAGATCTTGGAGG + Intronic
1118506827 14:66422702-66422724 TGGGTGGGAAAAGATCCTGATGG - Intergenic
1126220309 15:46205726-46205748 TGTGATTCAGAAGATCCTGCTGG - Intergenic
1130374285 15:83314363-83314385 TGGGATGTAAAAGATCCAGAGGG - Intergenic
1132481291 16:167469-167491 TGGGGTGGCAACGACCCTGCAGG - Intergenic
1134055479 16:11167275-11167297 TGGGGCACAGAACATCCTGCTGG - Intronic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1142666181 17:1465184-1465206 TGGGCTGCAAAAGATGCAGATGG + Exonic
1143459760 17:7094738-7094760 TGGGTCACAAAAGATCCTGCGGG - Intergenic
1144862011 17:18310664-18310686 TGGGGTGAAAAAAAACCTTCTGG + Intronic
1145077294 17:19867050-19867072 CTGGGTGCAAACGCTCCTGCGGG + Intronic
1145300706 17:21634192-21634214 TGGGGTGCCAAGGAACGTGCTGG - Intergenic
1147122354 17:38343261-38343283 TGGGGAGGAAACCATCCTGCAGG - Exonic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148493279 17:48037149-48037171 TTGGGTGCAGAAGGTCCTTCCGG + Intronic
1152093401 17:78258914-78258936 TAGGGCGCTATAGATCCTGCAGG - Intergenic
1153156964 18:2160764-2160786 GTGGGTGCAAAAGATCCTAAGGG + Intergenic
1154367401 18:13724096-13724118 TGGGTTGAAATAAATCCTGCAGG + Intronic
1162041407 19:7973111-7973133 TGGGGTGAAAAGGACACTGCAGG - Intronic
1164804654 19:31107476-31107498 TGGGGCCCAGTAGATCCTGCCGG - Intergenic
1167512710 19:49904506-49904528 TGGGGTGCTCAAGATCCTTTGGG + Intronic
1168438178 19:56338967-56338989 TGGAGTGCAAAAATGCCTGCAGG + Intronic
925397464 2:3545700-3545722 TGGTGTGGAAAATAGCCTGCAGG - Exonic
927150830 2:20194829-20194851 TGGTCTCCAAATGATCCTGCTGG - Intergenic
929272917 2:39993403-39993425 TGGTGTGCTCAAGAGCCTGCGGG + Intergenic
932471560 2:71962697-71962719 TGGGAGGCAAAAGACCCTGAGGG - Intergenic
933482778 2:82877674-82877696 TGTGTTGCAAGAGATCCTGAAGG + Intergenic
941606749 2:167606991-167607013 TGGCCTACAAAAGATCCTGCAGG + Intergenic
942018164 2:171838790-171838812 TGGCTTCCAAATGATCCTGCAGG + Intronic
946686400 2:222276165-222276187 TGGGTTGCACATGATTCTGCCGG - Intronic
947169642 2:227298470-227298492 TGGGGAGAAGCAGATCCTGCTGG + Intronic
947905082 2:233755272-233755294 TGGACTGCCAAAGAGCCTGCGGG + Intronic
948483076 2:238262526-238262548 TGGGATGAAACAGCTCCTGCTGG - Intronic
1169860417 20:10145551-10145573 TTGGGTGCAAAAGATCTCACAGG - Intergenic
1172415011 20:34758032-34758054 GGGGGAGCTAAAGATCCTGAGGG + Exonic
1173929864 20:46809579-46809601 TGGGCTACAAAACCTCCTGCAGG - Intergenic
1176651322 21:9550365-9550387 TGGGGTGCCAAGGAACGTGCTGG - Intergenic
1177134393 21:17293367-17293389 TGCGTTACAAAAGATCCTGAAGG + Intergenic
1179894285 21:44352565-44352587 TGGGATGCAAAAGATCTGACTGG - Intronic
1181175488 22:21032507-21032529 TGGGTTGCAGCAGATCCTGCGGG - Intronic
1182034731 22:27188954-27188976 TTAGGTGAACAAGATCCTGCAGG - Intergenic
1184813087 22:46850598-46850620 TGGTGTGGAAAAGAGCCTGAAGG + Intronic
949931051 3:9078708-9078730 TGGGGGGCAGAACAGCCTGCTGG - Intronic
950954997 3:17043263-17043285 TGTGTTGCCAAAGCTCCTGCTGG + Intronic
952652002 3:35738256-35738278 TGGGGAGGAAAAGAGACTGCTGG - Exonic
954083345 3:48225173-48225195 TGGGGCCCCAAAGCTCCTGCGGG + Intronic
956332028 3:68121560-68121582 TGGAGTGCAAATGAACCAGCTGG + Intronic
956770014 3:72517398-72517420 TGGGGTGGAAAAGATCTTCCTGG - Intergenic
959968107 3:112379143-112379165 TGGATTGCAAAAGAACCCGCAGG + Intergenic
963128505 3:141836701-141836723 TGGGGTGCAAAGGGTCCCCCAGG - Intergenic
965369557 3:167843881-167843903 TTTGGTGCAAAAGTACCTGCGGG - Intergenic
966162632 3:176984226-176984248 AGAGGTGGAACAGATCCTGCGGG - Intergenic
973773812 4:54228251-54228273 TCGGGAGGAAACGATCCTGCCGG - Intronic
979194308 4:117901595-117901617 TGGGGTGTCAAAGATCATTCTGG - Intergenic
984199438 4:176699334-176699356 TGGGGTACAGAACATCCTGTTGG - Intronic
984627247 4:182021063-182021085 TGGGTTGAAAAAGTTCCTGTGGG - Intergenic
984857211 4:184205565-184205587 TGGGGTACAACAGAACCCGCTGG + Intronic
985827104 5:2200591-2200613 TTGGGTGCAATAGATCTTGTAGG + Intergenic
987629350 5:20447647-20447669 TGGAGTGTAAAAGATATTGCGGG - Intronic
988537645 5:32083407-32083429 TCGGGTGTAGAAGAGCCTGCAGG - Intronic
990166706 5:53002619-53002641 TGGGGGGCAAAATATCCCACAGG - Intronic
990515594 5:56528334-56528356 TGTGGTGCAGCAGATGCTGCTGG + Intronic
992680928 5:79152352-79152374 TGGGGTGCAAATGTCCCTCCCGG - Intronic
998369242 5:141650622-141650644 TGGGGTGGGGAGGATCCTGCTGG - Intronic
1000585867 5:163098184-163098206 TGGGGTGAAAAAGTACATGCAGG + Intergenic
1000861082 5:166456846-166456868 TGGGGGGAAAAAGATGTTGCTGG - Intergenic
1002428926 5:179191893-179191915 TGGGATGCAGCAGCTCCTGCTGG + Intronic
1002779023 6:352505-352527 TTGGGACCAAAAGATCCAGCAGG - Intergenic
1008154456 6:47996497-47996519 TGGGGTGCAGAGGGTACTGCGGG - Intronic
1010029110 6:71254600-71254622 TAGAAAGCAAAAGATCCTGCAGG - Intergenic
1010613095 6:77980245-77980267 TGCCTTGCAACAGATCCTGCAGG - Intergenic
1011187306 6:84692343-84692365 GGGGGTGTACCAGATCCTGCAGG - Intronic
1015200572 6:130575378-130575400 TGTTGTACATAAGATCCTGCTGG + Intergenic
1017721230 6:157244531-157244553 TGGGGAGAAAGTGATCCTGCTGG - Intergenic
1018769733 6:166959901-166959923 TGAGGTTTAAAAGATGCTGCTGG + Intergenic
1019333399 7:471343-471365 AGGGGTGCACAGGATCCTGGCGG - Intergenic
1019686965 7:2387319-2387341 TGGGGTCCCCAAGATCCTCCCGG + Intergenic
1023093892 7:36640866-36640888 TGAGGTAGAAAAGAGCCTGCAGG + Intronic
1023753383 7:43393052-43393074 TGGGGTGTAGAAGATTCTGCAGG - Intronic
1031613807 7:123857224-123857246 TGGGGTACAAAAAAACCTCCTGG + Intronic
1034315096 7:150123510-150123532 TTGTGTGCAAGAGATGCTGCTGG - Intergenic
1034803001 7:154064312-154064334 TGATGTGCAAAAGGTCCTGCTGG - Intronic
1037615337 8:20514152-20514174 TGGGCTTCAAAAGATGCTGGTGG + Intergenic
1045004002 8:97901650-97901672 TTGGGTGCCAAGGATACTGCAGG + Intronic
1048107062 8:131422348-131422370 AGGGGAACTAAAGATCCTGCAGG - Intergenic
1049131420 8:140847188-140847210 TGGAGTCCAAAATATGCTGCTGG - Intronic
1049971060 9:822453-822475 TAGGTTGAAAAAGATCCTTCTGG + Intergenic
1051389894 9:16552628-16552650 TGTGCGGCTAAAGATCCTGCTGG - Exonic
1056105967 9:83346566-83346588 TTGGGTGCAAAATTTCCTACTGG + Intronic
1058798739 9:108523945-108523967 GAGGATGCAAAAGATCCTCCAGG - Intergenic
1061859913 9:133462699-133462721 TTGGGTGCAAGAGACCCTGCTGG + Intronic
1203629055 Un_KI270750v1:53917-53939 TGGGGTGCCAAGGAACGTGCTGG - Intergenic
1186503449 X:10071015-10071037 TGAGTTGCTAAGGATCCTGCAGG + Intronic
1186693788 X:12007526-12007548 TGGGTTTCAGAAGCTCCTGCAGG - Intergenic
1194225783 X:91255366-91255388 TGTGGAACAAAAGAGCCTGCAGG - Intergenic
1198464996 X:136897179-136897201 AGGGGTGCAAAAGTAACTGCGGG + Intergenic
1200239836 X:154487656-154487678 AGGGGTGCAGAACAGCCTGCTGG - Exonic
1201447621 Y:14075453-14075475 TGGGGTGCAGGAGGTCCTGAGGG + Intergenic