ID: 1097109116

View in Genome Browser
Species Human (GRCh38)
Location 12:56645208-56645230
Sequence ATGCCCTGGAAGTGCAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097109116_1097109121 9 Left 1097109116 12:56645208-56645230 CCTGCCTTGCACTTCCAGGGCAT 0: 1
1: 0
2: 2
3: 22
4: 236
Right 1097109121 12:56645240-56645262 GTGGTAGTCCCTCATCAAACTGG 0: 1
1: 1
2: 0
3: 2
4: 39
1097109116_1097109119 -10 Left 1097109116 12:56645208-56645230 CCTGCCTTGCACTTCCAGGGCAT 0: 1
1: 0
2: 2
3: 22
4: 236
Right 1097109119 12:56645221-56645243 TCCAGGGCATTTAGAATTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097109116 Original CRISPR ATGCCCTGGAAGTGCAAGGC AGG (reversed) Exonic
900627236 1:3614033-3614055 ATGGCCTGGGAGGGCACGGCAGG - Intergenic
900864035 1:5254673-5254695 CTTCCCTGCAAGTGCAAGGTAGG - Intergenic
901127717 1:6941079-6941101 ATGGCCTGGAAGTGCAGAGCAGG + Intronic
901218808 1:7570582-7570604 TTGTCCTGAAAGTGGAAGGCAGG + Intronic
901782395 1:11602572-11602594 ATCCCCTGGGAGGGCCAGGCAGG - Intergenic
905714333 1:40135137-40135159 GTGCTTTGGAAGTCCAAGGCAGG - Intergenic
905980577 1:42222176-42222198 ATGCCCTCAAAGCGCAAGACAGG - Intronic
906068297 1:42998447-42998469 AAGCCCTGGGAGTGGAATGCAGG + Intergenic
906950218 1:50329003-50329025 TTGCCCAGGGAGTGCAGGGCTGG - Intergenic
908114474 1:60927410-60927432 ATGCCAGGGAAGAGCAAGGAGGG - Intronic
914981545 1:152418973-152418995 TTGCCCTGGAAATGCCAGGGAGG + Intergenic
917624630 1:176833150-176833172 ATCTCCTGGAAGGGCAAGGGTGG - Intronic
920013079 1:202884472-202884494 ATGCAGTGGAAGTGACAGGCTGG + Intronic
921053593 1:211527869-211527891 ATGTCCTCAAAGTGCCAGGCTGG + Intergenic
924013526 1:239693783-239693805 ATGCCATGCAAGTGAAATGCAGG + Intronic
1063189234 10:3678486-3678508 CTGCCCTGGGGGTGTAAGGCCGG - Intergenic
1063754280 10:8988554-8988576 TTGCCTTGGTAGTACAAGGCAGG + Intergenic
1065239918 10:23694930-23694952 ATGCCCTGAAACTGCAAGTCGGG + Intronic
1065957019 10:30702888-30702910 ATGCCCTGGGAGTGGCACGCTGG - Intergenic
1066454109 10:35558255-35558277 CTACCCTGGAAGGGAAAGGCAGG - Intronic
1067147446 10:43703568-43703590 CTGCCCAGGAAGTACAGGGCTGG - Intergenic
1067699163 10:48556203-48556225 ACAGCCTGGAAGTGCAAGGCTGG - Intronic
1068116643 10:52743648-52743670 ATGCCCTGAGAGAGCAAGGTGGG + Intergenic
1068976115 10:63011487-63011509 ATGCTTTGGGAGTCCAAGGCGGG - Intergenic
1069169957 10:65214482-65214504 CTGTCCTGAAAGTGCAAGGGAGG + Intergenic
1069598457 10:69687717-69687739 ATGCCTTGGAAGATCAAAGCAGG + Intronic
1070020797 10:72583525-72583547 ATGCCTTGGGAGGCCAAGGCAGG - Intronic
1075608979 10:123836345-123836367 ATTACCTGGAGGTGCAGGGCAGG - Intronic
1076218402 10:128713990-128714012 ATCCCCTGGAAGAGGAAGGTGGG + Intergenic
1076354736 10:129843325-129843347 CTGCCTTCGAAGTGCACGGCAGG - Intronic
1079061223 11:17250699-17250721 ATGCCTTTGAAGTCCAAGTCAGG + Intronic
1083461588 11:62816525-62816547 GTGCTCTGGGAGTTCAAGGCGGG - Intronic
1083859312 11:65411524-65411546 ATGCCCGGGCTGTGCAAAGCTGG + Exonic
1084021927 11:66422868-66422890 ATGGCCAGGAAGAGCGAGGCAGG - Exonic
1084365722 11:68696348-68696370 TTGCCCTGGAGGGGAAAGGCTGG - Intergenic
1084695726 11:70754421-70754443 TTATCCTGGGAGTGCAAGGCTGG + Intronic
1085318957 11:75562739-75562761 GTGACCTGGAACTGCGAGGCCGG - Exonic
1085518231 11:77123579-77123601 AGGGCCTTGAAGTGCAAGCCTGG - Intronic
1085804199 11:79619470-79619492 ACACCCAGGAAGAGCAAGGCAGG - Intergenic
1086994532 11:93341169-93341191 ATGCTTTGGAAGGCCAAGGCAGG + Intronic
1087150474 11:94855108-94855130 ATACCAGGGAAATGCAAGGCAGG + Intronic
1087550494 11:99641509-99641531 ATGTCCTGGAAGTTCACGGGTGG + Intronic
1088925556 11:114297731-114297753 ATACTCTGGAAGGCCAAGGCAGG - Intronic
1088930279 11:114344337-114344359 ATGCTTTGGAAGGGCAAGGTGGG + Intergenic
1089178576 11:116565489-116565511 AGGACCTGGAAGTCCAAGTCTGG - Intergenic
1089238074 11:117050042-117050064 ATGCTCTGGGAGGCCAAGGCAGG + Intronic
1091230335 11:133984091-133984113 AAGCACTGGAAGGGAAAGGCTGG + Intergenic
1091252877 11:134158402-134158424 TTGCCCTGGGTGTGCAGGGCTGG + Exonic
1092057094 12:5516561-5516583 ATCCCCTGGAAGGGCAGGGTGGG + Intronic
1092186533 12:6483746-6483768 ATGTTCTGGAAGTGGAGGGCGGG + Intergenic
1092753221 12:11738392-11738414 GAGCCCAAGAAGTGCAAGGCTGG - Intronic
1094288786 12:28822467-28822489 ATGCTTTGGAAGGCCAAGGCAGG + Intergenic
1094696132 12:32820714-32820736 ATGCCCTGGAAGTGCACATCTGG + Intronic
1097109116 12:56645208-56645230 ATGCCCTGGAAGTGCAAGGCAGG - Exonic
1101384002 12:104239906-104239928 TTGTCCTGGGAATGCAAGGCTGG - Intronic
1101572613 12:105967890-105967912 TTGTCCTGAAAATGCAAGGCTGG + Intergenic
1102007145 12:109596229-109596251 AACCCCTGGGGGTGCAAGGCTGG + Intronic
1102344457 12:112150493-112150515 ATGCTTTGGGAGTCCAAGGCAGG - Intronic
1102360514 12:112283752-112283774 AGGCCCTGGCAGAGCAAGCCTGG + Intronic
1103864391 12:124040342-124040364 ATCCCCAGGAAGTCCTAGGCAGG - Intronic
1104250308 12:127087239-127087261 ATGCACACAAAGTGCAAGGCAGG - Intergenic
1104361552 12:128137907-128137929 AGGCCCTGGGTGTGCAAGGATGG - Intergenic
1105031667 12:132888183-132888205 ATTCCCTGAAAGTGAAAGGTCGG + Intronic
1106925361 13:34607674-34607696 AGGCCTTGGCAGTGCAAGGCGGG - Intergenic
1107580196 13:41775498-41775520 ATCCCCACGAAGAGCAAGGCAGG - Intronic
1108603490 13:52015154-52015176 ATGCTTTGGAAGGCCAAGGCAGG + Intronic
1109463670 13:62698163-62698185 ATGACCTTGAAGTGCAGTGCAGG - Intergenic
1111171191 13:84528414-84528436 ATGCACTGGTAGGGCAAGGATGG + Intergenic
1112431713 13:99355899-99355921 AGGCCCTGGAGGTGCAGGGAAGG - Intronic
1112756274 13:102637795-102637817 AAGCCCTGGGAGGCCAAGGCAGG - Intronic
1117239490 14:53815081-53815103 ATTCCCTGGATGTGCAAGTGCGG - Intergenic
1118707682 14:68495172-68495194 ATGCCCAGGAGAAGCAAGGCAGG - Intronic
1118708102 14:68498651-68498673 ATGCTCTTGAAGGGCAAAGCAGG + Intronic
1118922474 14:70162141-70162163 ATGCTCTGGAAGTGTGAGTCCGG - Intronic
1122032923 14:98926659-98926681 ATCCCCTGGAAAATCAAGGCTGG + Intergenic
1122179398 14:99944393-99944415 ATGCGCAGGCAGTGCCAGGCAGG + Intergenic
1122425316 14:101602207-101602229 CTGCCCTGGGAGTGCCAGGAGGG - Intergenic
1122715120 14:103692014-103692036 ATGCTTTGGAAGGCCAAGGCAGG - Intergenic
1122802446 14:104238448-104238470 AGGCCCTGGAATTGCAGGGCTGG + Intergenic
1123879091 15:24657842-24657864 ACGCTTTGGAAGTCCAAGGCAGG - Intergenic
1123894238 15:24812234-24812256 ATCCCCTGGAAGCACAAAGCTGG + Intergenic
1124031237 15:26014072-26014094 TGGCCCTGGAATTCCAAGGCTGG + Intergenic
1124897138 15:33787982-33788004 ATGGCCTGGAAGAGCAGAGCAGG + Intronic
1124930918 15:34118540-34118562 ATGCCTTGGGAGGCCAAGGCGGG - Intergenic
1126211294 15:46103941-46103963 ATGTCCAAGAAATGCAAGGCAGG + Intergenic
1129044146 15:72718720-72718742 ATGCCCTGGAGATGCAAAGATGG + Intronic
1129932753 15:79425961-79425983 ATGCCCTGGAAGTCCCAGACAGG - Intronic
1130035182 15:80353506-80353528 ATGTACTGGAAGTTCTAGGCAGG + Intronic
1130092200 15:80830425-80830447 ATGCCCTGGAAGTGCCCTTCTGG + Intronic
1130343491 15:83020026-83020048 ATGCCTTGGGAGGCCAAGGCAGG + Intronic
1131912029 15:97216995-97217017 ATGCTTTGGGAGTCCAAGGCAGG - Intergenic
1134568323 16:15270076-15270098 AGACCCTGGCAGGGCAAGGCAGG + Intergenic
1134734108 16:16486284-16486306 AGACCCTGGCAGGGCAAGGCAGG - Intergenic
1134933391 16:18225997-18226019 AGACCCTGGCAGGGCAAGGCAGG + Intergenic
1136999269 16:35215185-35215207 GTGGCCTGGAAGTGGAAGGCAGG - Intergenic
1137003683 16:35252950-35252972 GTGGCCTGGATGTGGAAGGCGGG + Intergenic
1137816643 16:51404418-51404440 CTGCCCTGGGAGTGCTGGGCTGG - Intergenic
1139214705 16:65116011-65116033 AAGGCCTGTAAGTGCACGGCTGG - Intronic
1139371928 16:66474348-66474370 ATGCCTTGGAGGTGCCAGGCTGG - Intronic
1141935593 16:87236061-87236083 AGCCCCTGGATGGGCAAGGCAGG + Intronic
1142338897 16:89508161-89508183 AGGCCCTGGGAATACAAGGCCGG + Intronic
1143540687 17:7566717-7566739 ATGCTCTGGAAGGCCGAGGCAGG + Intronic
1143616133 17:8050926-8050948 CAGCACTGGAAGTCCAAGGCAGG + Intergenic
1144968022 17:19089788-19089810 TTGGACTGGAAGAGCAAGGCGGG + Intergenic
1144979895 17:19162275-19162297 TTGGACTGGAAGAGCAAGGCGGG - Intergenic
1144988327 17:19215957-19215979 TTGGACTGGAAGAGCAAGGCGGG + Intronic
1146394961 17:32457481-32457503 AGGACTTGGAAGGGCAAGGCAGG - Intronic
1146718339 17:35104913-35104935 ATGCTTTGGAAGGCCAAGGCAGG - Intronic
1148122296 17:45220565-45220587 GTGCCCTGGAAGTGTAGGGAGGG + Intergenic
1149399887 17:56285281-56285303 ATTCCCTGGAACTGCTGGGCTGG + Intronic
1150329933 17:64286553-64286575 CTGTCCTGGGAGTCCAAGGCAGG + Intergenic
1152348607 17:79770229-79770251 ATGCCCTGGAGGAGAAGGGCGGG - Intergenic
1155132980 18:22956581-22956603 ATACCGTGGAAGGCCAAGGCAGG - Intronic
1155583147 18:27335024-27335046 ATGCACAGAAATTGCAAGGCAGG - Intergenic
1157099312 18:44715119-44715141 ATGCCCCAGCAGGGCAAGGCAGG - Intronic
1157942276 18:51942407-51942429 ATACCCTGAAGGTGCAATGCAGG - Intergenic
1159883328 18:73880704-73880726 ATGCCCTCTTAGTGCCAGGCAGG - Intergenic
1160130165 18:76218350-76218372 ATGCACTGGAACTGGAAGGCAGG - Intergenic
1160346714 18:78138132-78138154 ATGCCCTGGGGGTGCATTGCAGG + Intergenic
1161703602 19:5807480-5807502 CAGCCCTGCAAGTGCAAGGCTGG - Intergenic
1162569164 19:11460903-11460925 GTGCTCTGGAAGTTCAAGGCAGG + Intronic
1162999693 19:14358989-14359011 ATGCTCTGGGAGGCCAAGGCGGG - Intergenic
1163054218 19:14706208-14706230 ATCCCTTAGAAGTGCAAGTCAGG + Intronic
1163889998 19:20002337-20002359 TTGCCTTGGGAGTCCAAGGCGGG - Intronic
1164658228 19:29940287-29940309 TTGGCCAGGAAGTGCAAAGCAGG - Intronic
1165066651 19:33232982-33233004 ATGCCCTGGAAATGCCAGGTTGG - Intergenic
1168306817 19:55440469-55440491 AGGACCCGGCAGTGCAAGGCGGG + Intronic
1168650604 19:58089860-58089882 ATGTCCTGGAAGAGCCAGGTGGG - Exonic
926072343 2:9907874-9907896 AGGCCCTGGAAGGGGAAGACTGG - Intronic
927676489 2:25110228-25110250 AGGCCCTGGGAGGGTAAGGCAGG - Intronic
929451195 2:42038769-42038791 ATGCTTTGGAAGGCCAAGGCAGG + Intergenic
929523276 2:42675021-42675043 AGGCCCTGGGAGGCCAAGGCAGG - Intronic
932752416 2:74379840-74379862 AAGCCCTGGTGGTGTAAGGCTGG - Intronic
933306621 2:80608353-80608375 TTGCCTTGGAAGTGCAACGGTGG - Intronic
934489537 2:94751284-94751306 AAGCCCTGTGAGTGAAAGGCAGG + Intergenic
934906189 2:98206398-98206420 ATGCCCAGCAAGTACAAGGCAGG + Intronic
935171728 2:100615441-100615463 CTTCCCTGGAAGTGGAAGGGCGG + Intergenic
936267383 2:111021027-111021049 GTGCCCCTGAGGTGCAAGGCTGG - Intronic
940113848 2:150185684-150185706 ATGCCCTGGAAATGGAAGGCTGG + Intergenic
940199326 2:151132714-151132736 ATAACATGGAAGTGCAAGGCGGG - Intergenic
940783936 2:157961755-157961777 ATCCCCTTGTAGTGCAAGCCTGG - Intronic
941444491 2:165583697-165583719 AGACCGGGGAAGTGCAAGGCAGG - Intronic
948081919 2:235213801-235213823 AGGCCCTGGTTTTGCAAGGCTGG - Intergenic
948149442 2:235733254-235733276 AAGCCTTGGAAGTGAATGGCCGG - Intronic
948333869 2:237192981-237193003 ATGCCCTGCCAGGGCAAGGAAGG + Intergenic
948894731 2:240922795-240922817 ATGGCCTGGCAGGGCAGGGCAGG + Intronic
949024862 2:241762498-241762520 AAGCCCAAGAAGTGCCAGGCAGG - Intronic
1168968851 20:1917121-1917143 ATGCCCTGGATGAGAAAGGAGGG + Intronic
1169735126 20:8829587-8829609 ATGCCCTGGCAATGCACGCCTGG + Intronic
1170586892 20:17741529-17741551 AGGCCCTGGCAGTGGAAGGTGGG + Intergenic
1172441944 20:34971983-34972005 ATGACCTAGAACTCCAAGGCAGG - Intergenic
1174430361 20:50464046-50464068 ATGCCCAGAAAGTGCATGGTAGG - Intergenic
1174581388 20:51574200-51574222 ATGCCCTGGCAATGCAAGCCCGG - Intergenic
1175952472 20:62590799-62590821 AGGGCCTGGGAGTGCCAGGCAGG - Intergenic
1176385043 21:6134943-6134965 AGGAGCTGGAAGTGCAGGGCAGG + Intergenic
1177851032 21:26348851-26348873 ATGCTCTGGGAGGCCAAGGCAGG - Intergenic
1178457136 21:32765886-32765908 ATCCCCTGGGAGGCCAAGGCGGG + Intronic
1179332857 21:40422237-40422259 ATGCCCTCGAAGGCCAAGACTGG - Intronic
1179738430 21:43403309-43403331 AGGAGCTGGAAGTGCAGGGCAGG - Intergenic
1182725344 22:32440967-32440989 ATGCCTTTGAAGAGTAAGGCCGG - Intronic
1183348701 22:37322307-37322329 ATGCCCTGGGATTGCAGGGTAGG + Intergenic
1184379548 22:44136530-44136552 AGGGCCTGGAAGGGCAAGACAGG - Intronic
1184393379 22:44218502-44218524 ATGCCCTGGAATCTCAAGGTTGG - Intronic
1184640859 22:45869272-45869294 ATGCAGTGGGAGTGGAAGGCTGG - Intergenic
949408019 3:3735040-3735062 ATGCCCAGGAAGTGCCTGGATGG + Intronic
950118762 3:10468094-10468116 ATGCCAGGGAAGTGGGAGGCGGG + Intronic
950137476 3:10591849-10591871 ATGCCCTGGAATTGAAGGTCAGG - Intronic
950459887 3:13115016-13115038 AGGCCCTGGAGGTGCCGGGCAGG + Intergenic
952600162 3:35070417-35070439 CTGCCCTAGGAGTGGAAGGCTGG - Intergenic
953393574 3:42548695-42548717 GTGCCCAGGGAGTGAAAGGCAGG + Intronic
953814539 3:46143780-46143802 ATGCAGTGGAAATGCAGGGCAGG - Intergenic
954843560 3:53534357-53534379 ATGCTCTGGACGTACAAGGCTGG - Intronic
956445083 3:69318219-69318241 ATACTTTGGAAGTCCAAGGCGGG - Intronic
960671878 3:120162338-120162360 ATGCCTTGGAAGGACAAGGCAGG - Intergenic
962061530 3:131932769-131932791 ATGCACTGGGAGGCCAAGGCAGG + Intronic
962988519 3:140557743-140557765 ATGCTCTGGGAGTGCTAGGTGGG - Intronic
964324308 3:155530011-155530033 ATGCCTTGGGAGGCCAAGGCGGG - Intronic
968688486 4:1977120-1977142 CTGTCCTGGATGTGCAGGGCAGG + Intronic
968953051 4:3704395-3704417 AGGCCCTGGAATTGCAGGGAAGG - Intergenic
972739571 4:41877636-41877658 CAGCCCTGGAAGTGCCAAGCTGG - Intergenic
976715148 4:88115662-88115684 ATGCCCTGCAAATCCAAGGTTGG - Intronic
977924802 4:102687664-102687686 GTGCCATGGAAGTGCAGAGCAGG - Intronic
978568763 4:110113331-110113353 ATGCTTTGGGAGGGCAAGGCGGG + Intronic
982166455 4:152617871-152617893 GTGGCCTGAGAGTGCAAGGCTGG - Intergenic
982199227 4:152943675-152943697 CTGCCTTGGAAATGCTAGGCAGG + Intronic
983217469 4:165015585-165015607 ATGCCCGGGCAGCGCCAGGCAGG - Intergenic
983438360 4:167747385-167747407 ATGCTCTGGGAGGCCAAGGCAGG + Intergenic
984645607 4:182216389-182216411 GTGCAGTGGAACTGCAAGGCAGG - Intronic
986423418 5:7606986-7607008 GTGCCCTGCATGTGCAGGGCAGG - Intronic
988999163 5:36743195-36743217 TTGCCATGGAGGTGGAAGGCAGG - Intergenic
989668711 5:43888557-43888579 TTGCCCTGGAAATGGAAGACAGG - Intergenic
989716917 5:44475055-44475077 ATGCTTTGGAAGGCCAAGGCAGG - Intergenic
995454558 5:112337858-112337880 ATTCCTTGGAAGTGAAAGTCAGG + Intronic
996015983 5:118534541-118534563 ATGCCTTGTAGGTGCAAGTCTGG - Intergenic
997497561 5:134342956-134342978 ATGCTTTGGGAGTCCAAGGCAGG + Intronic
997834711 5:137182865-137182887 GTGACCTGGAACTGAAAGGCAGG - Intronic
1000024684 5:157348274-157348296 ACGCCCTGGAATTCCCAGGCTGG + Intronic
1001592231 5:172873437-172873459 AGGCCCTGGCTGGGCAAGGCTGG - Intronic
1001636638 5:173214756-173214778 CTGCCCCTGAAGTGCAAGCCTGG - Intergenic
1002095469 5:176828410-176828432 ATGCCCAGGAAGCGCAGGGTGGG - Intronic
1002301126 5:178257704-178257726 CTGCCCTGGAGGGGCAAGGAGGG - Intronic
1003923653 6:10856515-10856537 AGGCCTTGGAAGTGGTAGGCTGG + Intronic
1004832451 6:19491715-19491737 ATTCCCTGGACCTGCAGGGCTGG - Intergenic
1007394271 6:41568760-41568782 AAGCCCTGGAAATGCAATCCTGG + Intronic
1007736816 6:43987143-43987165 CTGCCCAGCAAGTCCAAGGCTGG + Intergenic
1008456264 6:51714446-51714468 ATACCATGGAAGTGCATGACGGG + Intronic
1015325521 6:131919028-131919050 ATGCACTGGCAGGGCAAGGAAGG - Intergenic
1015383448 6:132595349-132595371 ATGCCCTAGAAATGTGAGGCCGG - Intergenic
1015803435 6:137084261-137084283 CTGCCCTGGAACTCCCAGGCTGG + Intergenic
1017036537 6:150272251-150272273 ATGCCCTGAAAGATCAATGCTGG + Intergenic
1017048527 6:150369616-150369638 AGGCCCTGGAAGTGAAAGCCTGG + Intronic
1017391802 6:153948036-153948058 ATGAACTGGAACTGCAAGCCAGG + Intergenic
1017459306 6:154634225-154634247 ATGCCTGCGAAGTGCAAAGCAGG - Intergenic
1018312043 6:162520001-162520023 ATGCTTTGGAAGGCCAAGGCAGG + Intronic
1019272432 7:157821-157843 AGGGCCTGGAAATGGAAGGCCGG + Intergenic
1019607434 7:1917233-1917255 ATGTGCTGGCAGTGCAGGGCGGG - Intronic
1019928246 7:4207155-4207177 CTGCCCAGCAAGAGCAAGGCGGG + Intronic
1019949855 7:4362521-4362543 ATGCTTTGGAAGGCCAAGGCAGG + Intergenic
1020255189 7:6498972-6498994 AAGCCCTGGAGGTGCAAGGAGGG - Intronic
1021441832 7:20686238-20686260 GTGCCCTGGGACTGCAAGCCTGG - Intronic
1021528315 7:21614071-21614093 ATGCTTTGGAATTGCGAGGCTGG - Intronic
1023132263 7:37014792-37014814 AGGCCCTGGAAGTCCAGGACAGG + Intronic
1026036372 7:66833078-66833100 ACGGCCTGGAGGGGCAAGGCTGG - Intergenic
1031052172 7:116954792-116954814 ATACTCTGGGAGTGCAAGTCTGG + Intronic
1032441048 7:131943398-131943420 ATGCCCTGGAAGGACTAGGGAGG - Intergenic
1033304615 7:140215319-140215341 ATGCCCTGCAAGGGGAAGGGAGG + Intergenic
1034077360 7:148245156-148245178 TTGCCATAGAAGAGCAAGGCTGG - Intronic
1037479880 8:19294684-19294706 ATGGCCTGGAATTGAAAGACGGG - Intergenic
1037521149 8:19681739-19681761 CTGCCCTGGGAATGCCAGGCTGG + Intronic
1038210615 8:25516216-25516238 ATGCCCAGGATGTGCCAGTCAGG - Intergenic
1038235078 8:25745284-25745306 ATGCCCTGGAAGTGAATGAGGGG + Intergenic
1038716743 8:29997995-29998017 AAGCCCTGAAAGGCCAAGGCAGG + Intergenic
1039475992 8:37839694-37839716 ATGCGCTGGAAGAAAAAGGCTGG + Intronic
1039561622 8:38516943-38516965 ATGCCCTGGCATTGGAGGGCAGG - Intronic
1039720348 8:40157561-40157583 ATGCTCTGGAAGCATAAGGCAGG + Intergenic
1039855673 8:41410604-41410626 AACTCCTGGAAGTGCAATGCTGG + Intergenic
1041699694 8:60774492-60774514 TTGCCCTAGAAGGGCCAGGCTGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1045487571 8:102644114-102644136 ATGCTTTGGAAGACCAAGGCAGG - Intergenic
1048609443 8:136005904-136005926 ATGTCCCGAACGTGCAAGGCAGG - Intergenic
1049553917 8:143273022-143273044 ATGCCCTGGCACTGACAGGCAGG - Intronic
1053035009 9:34818500-34818522 ACGCCATGGGAATGCAAGGCTGG - Intergenic
1053918057 9:42959267-42959289 AAGCCCTGTGAGTGAAAGGCAGG - Intergenic
1057010995 9:91601133-91601155 ATGCCCTGGATGGGCAAGCAAGG - Intronic
1057044958 9:91878566-91878588 AGGCACTGGATGTGCAAGGGGGG - Intronic
1059700793 9:116773865-116773887 ATGCCTTAGAAGTGCATGGGTGG - Intronic
1060548109 9:124472361-124472383 ATGCCCAGGAAGAGCCAGGTGGG - Intronic
1061074622 9:128333616-128333638 AAGCCCTGGACGTGCATGGGTGG - Exonic
1061388268 9:130303130-130303152 CTGCACTGGAAGTCCCAGGCTGG - Intronic
1062387527 9:136318907-136318929 ATGGCCATGAGGTGCAAGGCGGG - Intergenic
1185547736 X:959036-959058 ATTCCCTGGAAGTGCATGGCAGG - Intergenic
1185547767 X:959284-959306 ATTCCCTGGAAGTGCGTGGCAGG - Intergenic
1187515509 X:19966280-19966302 ATCCCCAGAAAGTGCAAGGAGGG - Exonic
1187583978 X:20639568-20639590 AGGCACTGGAAGTGCATGGCAGG - Intergenic
1188906815 X:35800287-35800309 AGCCCTTGGAAGTCCAAGGCAGG + Intronic
1189239171 X:39512446-39512468 TTGCCCTGGAAGTCACAGGCTGG + Intergenic
1189744474 X:44156075-44156097 TTTCCTTGGAAGTGCAATGCAGG + Intronic
1190233162 X:48597787-48597809 CTGCCCAGGAAGGGCAGGGCTGG + Intronic
1191846387 X:65550714-65550736 ATGCCCGGGCTGTGCAAAGCTGG - Intergenic
1193883823 X:86960449-86960471 ATGCCCTGGCAGGGCAGGGAAGG + Intergenic
1200105435 X:153709550-153709572 GTGCCCCCGAAGTGCAAGGTTGG + Intronic