ID: 1097119689

View in Genome Browser
Species Human (GRCh38)
Location 12:56721593-56721615
Sequence CAGGATTAGATAAAGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097119684_1097119689 26 Left 1097119684 12:56721544-56721566 CCTCCTAGGAAACACTGGAGTTT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1097119689 12:56721593-56721615 CAGGATTAGATAAAGGTGACAGG 0: 1
1: 0
2: 1
3: 10
4: 126
1097119685_1097119689 23 Left 1097119685 12:56721547-56721569 CCTAGGAAACACTGGAGTTTAAA 0: 1
1: 0
2: 3
3: 22
4: 250
Right 1097119689 12:56721593-56721615 CAGGATTAGATAAAGGTGACAGG 0: 1
1: 0
2: 1
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097119689 Original CRISPR CAGGATTAGATAAAGGTGAC AGG Intronic
900089276 1:912643-912665 CAGGAATAGAGAGAGGGGACTGG + Intergenic
900499785 1:2998165-2998187 CAAGGTTAGCTAGAGGTGACAGG + Intergenic
901249965 1:7770913-7770935 CAGTATTAGAGACAGATGACTGG - Intergenic
904102703 1:28046305-28046327 CAGGAAAAGATGAAGGTGATGGG + Intronic
904991706 1:34598549-34598571 CAGGATTAGTTACAGATCACTGG - Intergenic
907433552 1:54429379-54429401 CAGGAATAGATAAAAGAGAATGG + Intergenic
908486352 1:64597814-64597836 CGGAATTATATAAATGTGACTGG + Intronic
908997777 1:70178486-70178508 TATGATTAGGTAAAGGTGAGAGG + Intronic
915470409 1:156122747-156122769 CAGGATTAGAGAACAGTGCCTGG + Intronic
915723613 1:158002179-158002201 CAGTATAAGATAAAGATGCCTGG + Intronic
917411488 1:174763901-174763923 TAGAATTAGATAAAGGTGATGGG - Intronic
918141998 1:181727523-181727545 CAGGATGTGATAAAGGAGAGTGG + Intronic
920577859 1:207075182-207075204 CAGCATTAGAGACAGGTCACTGG + Exonic
921717565 1:218433852-218433874 CATGTTATGATAAAGGTGACAGG - Intronic
1063345924 10:5312399-5312421 TAGGATTAGATAAGGTTGAGAGG - Intergenic
1063675004 10:8133144-8133166 CAGGAGGAGAAAAAGATGACGGG - Intergenic
1064798628 10:19042885-19042907 CATGACTACATAAAGTTGACGGG - Intergenic
1066546240 10:36503414-36503436 CAGGATAAGATCCAGGTGTCAGG - Intergenic
1069230323 10:66001021-66001043 CAGGGTTAAATATAGGTGATGGG + Intronic
1069504418 10:68985164-68985186 AAATATTAGATAAGGGTGACTGG - Intergenic
1072195975 10:93117751-93117773 CAGGGTTAGAAAGAGGTGATGGG - Intergenic
1072984079 10:100124326-100124348 CAGGATTGGATACAGGTTAAAGG + Intergenic
1073667204 10:105546871-105546893 AAGGATTAGCTGAAGGTGAATGG - Intergenic
1076480675 10:130783398-130783420 CAGGCATAGAGAAAGCTGACAGG - Intergenic
1078369670 11:10734546-10734568 CTGGTTTAGAAAAAGCTGACTGG - Intergenic
1078912423 11:15745415-15745437 CAGAATATGGTAAAGGTGACAGG - Intergenic
1080656106 11:34259647-34259669 CAGCCTTAAAGAAAGGTGACCGG + Intronic
1082746237 11:56966395-56966417 CAGCATTAGATAATGGTAAAGGG - Intergenic
1084270061 11:68024179-68024201 CATGATTAAAGAAAGGTTACTGG + Intronic
1087307319 11:96502045-96502067 CAGGATTAACAAAAGGTAACAGG - Intronic
1088060088 11:105637275-105637297 AAGGATTGTTTAAAGGTGACAGG - Intronic
1088595000 11:111434886-111434908 CAGGATGAGTGAAAGGTGAGAGG - Intronic
1089275071 11:117329296-117329318 CAGGATTTCACAAAGGAGACTGG - Intronic
1089699431 11:120235639-120235661 CAGGATAAGGTAACTGTGACTGG - Intergenic
1090204242 11:124876042-124876064 CAGGGTTCGATAGAGGAGACCGG - Exonic
1092171252 12:6375258-6375280 CAGGATTAGAGAGAGGAGGCAGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095987514 12:48009321-48009343 CGGGAAAAGATAAAGGTGTCTGG + Intergenic
1097119689 12:56721593-56721615 CAGGATTAGATAAAGGTGACAGG + Intronic
1103406120 12:120676721-120676743 CAGAAATAAATAAAGCTGACCGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108707620 13:53003857-53003879 CAGGAGTATATAATGGTGCCTGG + Intergenic
1109102929 13:58209334-58209356 CAGGTTAAGATAAAGGTTATGGG + Intergenic
1110373714 13:74768215-74768237 CAGGGATAGATAAAGGTGAGTGG - Intergenic
1111368894 13:87289738-87289760 CTGGATTTGATACAGGTGAACGG + Intergenic
1116299600 14:43161153-43161175 CAGAATATGATAAAGGTGATAGG + Intergenic
1124103973 15:26720344-26720366 CAGGAGCTGATAGAGGTGACAGG - Intronic
1125081802 15:35683158-35683180 CAGGATCAGCTAAATTTGACTGG - Intergenic
1127508161 15:59614733-59614755 CAGGATGAGATAGAGGAGATAGG - Intronic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1130363182 15:83208605-83208627 CAGGATTGGAAACAAGTGACCGG - Intergenic
1130616407 15:85412889-85412911 CAGGATAAGATAAAGGTTAGAGG - Intronic
1134097841 16:11430891-11430913 CAGGTTTAGATAAAGGGGTATGG - Intronic
1135239548 16:20792197-20792219 CAGGAATACATACAGGTGAGTGG - Intronic
1138012388 16:53394568-53394590 CAGGATTTGATAAAGTTGACAGG + Intergenic
1139848817 16:69938665-69938687 CAGAATTAGATAGTGGTGCCAGG - Intronic
1147683653 17:42273663-42273685 CAAGATTAGATGCAGGTTACAGG - Intronic
1149401481 17:56300882-56300904 CAGGATTTGATTAAGGTGGAGGG - Intronic
1150325536 17:64253679-64253701 CAGGACTAGATAAGGGCGAAAGG + Intronic
1151341403 17:73473316-73473338 CAGGAGTGGATGAAGGGGACCGG + Intronic
1152239366 17:79153489-79153511 CAGGAGTGGCTAAAGCTGACAGG + Intronic
1152841576 17:82572241-82572263 CAGGATTAGATGAGGAAGACAGG - Intronic
1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG + Intergenic
1157542447 18:48521331-48521353 GAGAATTAGAGAAGGGTGACAGG + Intergenic
1159051506 18:63424741-63424763 CATGATTAGATTGAGGTTACAGG - Intergenic
1160780288 19:874632-874654 CAGGAGTAGAGAGAGGTGAAAGG + Intronic
1165115910 19:33528656-33528678 GAGGATTAGATGAATGTCACAGG + Intergenic
1166364050 19:42269604-42269626 CAGGACTAGATCAGGGTGACAGG + Intronic
925044282 2:759810-759832 CTGGCCTAGATAAAGGAGACTGG - Intergenic
925096207 2:1206066-1206088 CAAGATTACAAAAAGCTGACAGG + Intronic
925955762 2:8962362-8962384 GAGAATCAGATATAGGTGACTGG - Intronic
927462800 2:23313537-23313559 GAGGATTCGATAAAGCTGTCAGG - Intergenic
928303822 2:30148761-30148783 CAGGTTTAGAAAAAAGTGAAAGG + Intronic
930674815 2:54188968-54188990 CAGGAGAAGAGAGAGGTGACAGG - Intronic
932641768 2:73455210-73455232 CAGAATTAAATGAAGATGACAGG + Exonic
937398818 2:121563699-121563721 CAGGATTAGATAAGAGTGGGAGG - Intronic
941102964 2:161317677-161317699 CAGGATTCAACAAAGGTGATTGG + Intronic
942296612 2:174523759-174523781 CAGGATTGGATAGAGGAGAGGGG - Intergenic
943296265 2:186143862-186143884 CAGGAGAAGATGAAAGTGACTGG - Intergenic
944883381 2:204038537-204038559 CAGGATTAGACACAGCTGAGGGG - Intergenic
945077669 2:206056507-206056529 AAGAAGTAGATAAAGGTGACAGG + Exonic
945524213 2:210868032-210868054 CAGGATTACATAATGGTAAAGGG + Intergenic
1169046340 20:2537090-2537112 CAGTATCAGACAAATGTGACAGG + Intronic
1179384989 21:40933359-40933381 CATGATGAGGTAAGGGTGACAGG - Intergenic
949697859 3:6720102-6720124 CATGATTAGATTGAGGTTACAGG - Intergenic
954083535 3:48226283-48226305 CAGGGTGAAACAAAGGTGACTGG + Intergenic
955041899 3:55325560-55325582 CAGGATTAGAGCCAGGTGATGGG + Intergenic
957612922 3:82491915-82491937 AAGGAATAAAGAAAGGTGACTGG + Intergenic
959305694 3:104662992-104663014 CAAGTTTAGATAAAGGAGACTGG + Intergenic
965907465 3:173726604-173726626 AAGGTTTAGAGAAAGGTGACAGG - Intronic
966091612 3:176145045-176145067 CAGGATTAAAGCAAGGTGGCAGG + Intergenic
968530725 4:1090083-1090105 CAGGATGGGGTAAGGGTGACAGG + Intronic
968978715 4:3835296-3835318 CAGGATGAGGTGGAGGTGACAGG + Intergenic
970222984 4:13829525-13829547 TAGGATTAGATAAAGTTGTCAGG + Intergenic
971414636 4:26413022-26413044 TTGGATTAGATAAATGTGAGAGG + Intronic
971738997 4:30496707-30496729 CACAATTAAATAAAGGTTACAGG - Intergenic
982166346 4:152617015-152617037 CAGGAGTAGAGAAAAGTGTCAGG + Intergenic
987659899 5:20858741-20858763 CAGCAGTAGAAAAATGTGACGGG + Intergenic
988112273 5:26837847-26837869 CAGATGTAGATAAAGGAGACTGG + Intergenic
988313555 5:29593870-29593892 TAGGATTAAATAAATGTTACTGG + Intergenic
990844779 5:60124504-60124526 GAGGATTTGATAAATGTGATGGG - Intronic
992807553 5:80352245-80352267 CAGGATCAGGTAGAGGTAACTGG - Intergenic
993478420 5:88393231-88393253 CAGGAATAGTTAAAAGTGAGAGG - Intergenic
995806779 5:116061565-116061587 AAGGATTAGATAAAGGAATCTGG + Intergenic
996295247 5:121906917-121906939 TAGGACTAGATAAAGGACACAGG - Intergenic
998540710 5:142978851-142978873 CAAGATTTGATGAAGCTGACTGG - Intronic
998555372 5:143118067-143118089 GAGGATTGGAGAAAGGTGAAAGG + Intronic
999459480 5:151745564-151745586 CTGGATTACATAAAAGTGAAGGG + Intronic
999513605 5:152278315-152278337 TAGGAATAGATAAGGGTGCCAGG - Intergenic
1010265682 6:73863272-73863294 CAAGATAAAATAAAGGTCACAGG - Intergenic
1011030143 6:82913560-82913582 GAGGAAAAGATAATGGTGACAGG - Intronic
1014225905 6:118846585-118846607 CCGGAGTAGATAGAGGAGACCGG + Intronic
1017658758 6:156654033-156654055 GAGGATGAGGGAAAGGTGACTGG - Intergenic
1018095221 6:160381023-160381045 CAGGATTTGAAAAATGTGCCAGG + Intronic
1023498565 7:40824335-40824357 AAGGATTATATAAAGGTAAATGG + Intronic
1026829221 7:73600928-73600950 CAGGGTCAGAGAAAGGTGCCCGG - Intronic
1030196615 7:106859214-106859236 CAGGTTCAGAAAAAGGTCACAGG - Intergenic
1030957480 7:115872912-115872934 CAGGTCTAGGAAAAGGTGACTGG + Intergenic
1031464483 7:122091579-122091601 CAGGAGGAGATAATGGAGACAGG + Intronic
1032560811 7:132891524-132891546 CAGGATTAGATCAAGGCAGCTGG + Intronic
1033084187 7:138327012-138327034 TAGGATTTGAAAAAGGTGTCAGG + Intergenic
1038708693 8:29921021-29921043 CAGGACTAGTTAGTGGTGACTGG - Intergenic
1043329710 8:79100511-79100533 GTGGAGTAGATAAAGCTGACCGG + Intergenic
1045220479 8:100194465-100194487 GAGCACTAGAAAAAGGTGACAGG - Intronic
1045634192 8:104164073-104164095 AAGGATTTGATAAAGGTGGGTGG - Intronic
1046353513 8:113047149-113047171 CAGGATGGGATAAAGGAGACAGG - Intronic
1047212710 8:122853060-122853082 CAGGAAGAGGTAAATGTGACTGG - Intronic
1051297575 9:15612905-15612927 CAGGTTTATGTAATGGTGACAGG + Intronic
1055740266 9:79380654-79380676 CCGGATGAAATAAAGTTGACAGG - Intergenic
1057689132 9:97267683-97267705 CATGATTAGACTAAGGTGATGGG + Intergenic
1060828882 9:126701701-126701723 TCCGATTAGATCAAGGTGACTGG + Intergenic
1187101878 X:16201415-16201437 CAGGGTAAGGTAAAGGTGAGGGG + Intergenic
1191026296 X:55917367-55917389 AAGAATTGGATAAAGGAGACAGG - Intergenic
1197471665 X:126870556-126870578 CAGGATGATATAATCGTGACTGG + Intergenic
1197594649 X:128451036-128451058 CAGGATTAGAGAAAGCTATCTGG - Intergenic
1197745783 X:129931775-129931797 AAGGATTAGAGAAGGGTGGCGGG - Intergenic
1198797466 X:140414240-140414262 CAGAATATGACAAAGGTGACAGG - Intergenic
1201289612 Y:12410296-12410318 CAGGATTAGATAGAGGTGGTGGG - Intergenic