ID: 1097119818

View in Genome Browser
Species Human (GRCh38)
Location 12:56722718-56722740
Sequence TTGGAGTGGCGAGAATACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097119814_1097119818 10 Left 1097119814 12:56722685-56722707 CCGTCTCAAAACAAAACAAACCA 0: 5
1: 1458
2: 1436
3: 6592
4: 111445
Right 1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1097119817_1097119818 -10 Left 1097119817 12:56722705-56722727 CCAAAGAAGACAATTGGAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097119818 Original CRISPR TTGGAGTGGCGAGAATACAC TGG Intronic
901908431 1:12434584-12434606 TGGGGGTGGGGGGAATACACAGG - Intronic
902807999 1:18872686-18872708 TGGGAGAGGCCAGAATACAGTGG + Exonic
904342708 1:29847708-29847730 TGAGAGTGGCAGGAATACACTGG - Intergenic
906976429 1:50578084-50578106 TTGGAGTGGTGGGATTACAAAGG - Intronic
911337782 1:96601864-96601886 TTGGGGTGGAGAGAAAACATGGG - Intergenic
914825309 1:151135067-151135089 TTGGGGTGGCAGGAAAACACAGG - Intronic
917303640 1:173605129-173605151 ATGGAGTTGGGAGAAAACACTGG - Intergenic
919726711 1:200889122-200889144 TTGGAGTGGGGAGAAAGCATAGG - Intergenic
921108304 1:212006638-212006660 TTGGAGTAGGGAGAATATTCAGG - Exonic
1067184436 10:44014985-44015007 GCGGAGTGGGGAGAATTCACAGG - Intergenic
1069313714 10:67071703-67071725 AAGGAGAGGAGAGAATACACGGG - Intronic
1071571916 10:86701825-86701847 TTGGAATGGAGAGAATGCAGAGG + Intronic
1072753798 10:98003615-98003637 TTGGAATGGGGAGAATATTCTGG - Intronic
1074217118 10:111395747-111395769 TTGGAGTGGCAAGAATTGACTGG - Intergenic
1075736085 10:124665391-124665413 TTGGAGTGGAGAGGAGACACAGG - Intronic
1077900865 11:6487442-6487464 ATTGAGTGGTGAGAATACAACGG + Intronic
1082011556 11:47453064-47453086 TTGGAGTGGGGAGAATCTGCTGG - Intergenic
1088401015 11:109422747-109422769 TTGGAGAGGGGAGAATACCAGGG + Intronic
1090664968 11:128908836-128908858 CTGGGGTGTCCAGAATACACGGG + Intronic
1093937557 12:25017789-25017811 TTGGAGTGGTGAAAATATCCTGG - Intergenic
1094161214 12:27392996-27393018 GTGGAGGGGAGAGAATACAGAGG - Intronic
1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG + Intronic
1098147681 12:67514516-67514538 ATGGAGTGGTAAGAATACAATGG + Intergenic
1102137515 12:110587528-110587550 TTGGAGTGGTGAAAATATTCTGG + Intergenic
1103811239 12:123615580-123615602 TGGGAGTGAAGACAATACACAGG - Intronic
1104677043 12:130718185-130718207 TTGGGGTGGTGAGAACACATTGG + Intergenic
1105425450 13:20291091-20291113 TTGGAATGGCTAACATACACAGG - Intergenic
1107752498 13:43583862-43583884 TTGGAGTGATTAGAATACAAAGG - Intronic
1107891579 13:44919072-44919094 GAGGAGGGGCGAGAATAGACTGG + Intergenic
1108534185 13:51356426-51356448 CTGGAGTTGCAAGAAGACACTGG - Intronic
1111577035 13:90168478-90168500 TAGGACTGGCTAGGATACACTGG - Intergenic
1120515972 14:85470693-85470715 TTGCAGTGCCCTGAATACACAGG - Intergenic
1125810618 15:42537730-42537752 TTGCAGTGACATGAATACACTGG + Intronic
1126772870 15:52075122-52075144 TTGGAGGGGAGAGAATATAGAGG - Intergenic
1126885543 15:53145431-53145453 TTGGAGTGGGGAGAAGATAGTGG + Intergenic
1134810122 16:17160389-17160411 TTGGAGTGGCGAGACTGCAGAGG - Intronic
1146663460 17:34681014-34681036 TTGTACTGGCGAGGATACAGTGG + Intergenic
1150373414 17:64661589-64661611 TTGTGGAGGGGAGAATACACCGG - Intronic
1151948369 17:77331712-77331734 GTGGAGTGCAGAGAATGCACCGG + Intronic
1156822598 18:41390858-41390880 TTGGAGTTGCTGGAATAAACAGG - Intergenic
1157965340 18:52202607-52202629 CTGGAGTGGAGACAAAACACAGG - Intergenic
1165025619 19:32959121-32959143 TTGGAGTGGTGGGAAGACACTGG - Intronic
1168317889 19:55491931-55491953 TTGGGGTGGGGACAGTACACGGG + Intronic
930367800 2:50463352-50463374 TTTCAGTGGTGAGAATACATAGG - Intronic
932374659 2:71225537-71225559 TCGGGGTGGGGAGAATATACAGG - Intronic
936438895 2:112533193-112533215 TTGGAGTGGAGTGCCTACACAGG - Exonic
945466546 2:210176006-210176028 TTGGGGTGGGGAGAATTGACTGG + Intergenic
1170686347 20:18573154-18573176 TTGGAATTGCTAGAATACAGGGG - Intronic
1182710358 22:32318843-32318865 TTGGAGTGGAGAGAATGAAAAGG - Intergenic
1183523470 22:38310098-38310120 TTTGAGTGGAGAAAAAACACAGG - Intronic
954994149 3:54866342-54866364 TTGGGGAGGAGAGAAGACACAGG + Intronic
962783388 3:138743243-138743265 TGGGAATGGCTACAATACACAGG + Intronic
971213173 4:24639568-24639590 TGGGAGTGGGGAGAATTCAAAGG + Intergenic
973190693 4:47381939-47381961 TTGGAGGGGGGAGGATACAGGGG - Intronic
978046164 4:104130656-104130678 TTGGAGTGAAGAGAGTATACAGG - Intergenic
985694206 5:1330882-1330904 TTGGAGTGGCCAGCAGACAGTGG - Intronic
989136095 5:38156484-38156506 TTGAAGTGGAGAGATTACCCTGG - Intergenic
990947486 5:61264055-61264077 ATGGAGTAGTGAGAATAGACTGG - Intergenic
993203714 5:84850104-84850126 GTGGAGTGGAGAGATTAGACTGG + Intergenic
1000989371 5:167896263-167896285 TTGGAGAGACGAGAAAACATGGG + Intronic
1018517864 6:164607341-164607363 TTGCACTGGTGAGAATATACAGG - Intergenic
1019885850 7:3904331-3904353 TTGGAGTGGAAAAAATACTCTGG + Intronic
1021628732 7:22622790-22622812 TTGGAGTGTTGATAATACACAGG - Intronic
1031258078 7:119482132-119482154 TTGGAGTGTAGTGAATACAAAGG - Intergenic
1031687878 7:124754568-124754590 GTGAAGTGACTAGAATACACTGG + Intronic
1033727896 7:144140667-144140689 TTGAAGTGGGGAGTATACAAAGG + Intergenic
1046312551 8:112457309-112457331 ATGGAGTGAAGAGAATTCACAGG + Intronic
1048348398 8:133595679-133595701 CTGGAATGAGGAGAATACACTGG - Intergenic
1054800326 9:69341699-69341721 CTGGAGTGGTCAGAATACCCAGG + Intronic
1060725917 9:126005866-126005888 TTGGAATGGGCAGATTACACAGG - Intergenic
1189025538 X:37389810-37389832 TTGTAGGGGTGAGAATAGACTGG + Intronic
1192537242 X:71938718-71938740 ATGGAGTGAAGAGAATGCACTGG + Intergenic
1192724073 X:73729139-73729161 TTGGAGGGCCTAGAAAACACTGG - Intergenic
1194355369 X:92876503-92876525 TGGGAGTGGTGAGTATACATTGG - Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1200663725 Y:5993529-5993551 TGGGAGTGGTGAGTATACACTGG - Intergenic