ID: 1097122687

View in Genome Browser
Species Human (GRCh38)
Location 12:56747887-56747909
Sequence CAGAACCCCCAAAAGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097122683_1097122687 -10 Left 1097122683 12:56747874-56747896 CCAATTTATACCTCAGAACCCCC 0: 1
1: 0
2: 4
3: 10
4: 178
Right 1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 157
1097122682_1097122687 -9 Left 1097122682 12:56747873-56747895 CCCAATTTATACCTCAGAACCCC 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097122687 Original CRISPR CAGAACCCCCAAAAGGCTCA GGG Intronic
900166467 1:1246046-1246068 CAGGACCCCCAGAAAGCACAAGG + Intronic
901929108 1:12585649-12585671 CAGATTCCCCAGAAGGGTCAGGG - Intronic
903187822 1:21639223-21639245 CACTACCCCCAGAAGCCTCAGGG + Intronic
905051036 1:35051360-35051382 CAGAACTCCAGAAAGGCTCAAGG - Intergenic
906808991 1:48807409-48807431 CAAAACTCCCACAAGGCTCAGGG + Intronic
907473044 1:54686508-54686530 CAGAGCCTCCAAAAGTCTCAGGG + Intronic
909135790 1:71799000-71799022 CCCTACCCTCAAAAGGCTCAAGG - Intronic
911858100 1:102907870-102907892 CATATCCACCAAAAGACTCAAGG - Intronic
912803973 1:112741603-112741625 GAGAACCCCGCAAGGGCTCAAGG + Intergenic
915672529 1:157502480-157502502 CAGAACCAATAAAAGCCTCATGG + Intergenic
918739331 1:188107264-188107286 CAGAACCCCTCCAAGGCTTATGG - Intergenic
921251321 1:213301003-213301025 GAGAGCCCCAGAAAGGCTCAGGG - Intergenic
922967711 1:229705546-229705568 CAGAACAAGAAAAAGGCTCATGG + Intergenic
1063005021 10:1961918-1961940 CAGAACCCCCAAAAGGACAGGGG - Intergenic
1065114778 10:22474867-22474889 AACAATCCCCAAAACGCTCAAGG + Intergenic
1067684641 10:48459105-48459127 CAGAATCCCCAAACGGCCCTAGG + Intronic
1070162050 10:73872743-73872765 CAGTGGCCCCCAAAGGCTCAAGG - Intronic
1072831966 10:98668022-98668044 TAGAAAACCCAAAAGGCTCCTGG + Intronic
1075559364 10:123457181-123457203 CAGAACCACACAAAAGCTCAGGG + Intergenic
1076224772 10:128765238-128765260 CAGAAGCCCCAGAAGCCACAGGG - Intergenic
1078333251 11:10443332-10443354 CACAAGCCCCAAACAGCTCAGGG - Intronic
1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG + Intergenic
1083189204 11:61037089-61037111 CAGACCCCACAGAAGCCTCAGGG - Intergenic
1088665004 11:112085795-112085817 CATAACCCCCAAAAGGTTAATGG - Intronic
1090493955 11:127191608-127191630 CAGAACCAAAAAAAAGCTCAAGG - Intergenic
1090581591 11:128166121-128166143 AACAACCACGAAAAGGCTCAGGG + Intergenic
1090904628 11:131064511-131064533 CAGAACCCCCAAGAGCCACAGGG + Intergenic
1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG + Intronic
1091617384 12:2059757-2059779 CAGAGGCCCCTAAAGGTTCATGG + Intronic
1091685319 12:2557413-2557435 CAGAACCTACAAAAGGATCCAGG + Intronic
1095396903 12:41771962-41771984 CAGAATCCCAAGAAGGGTCAAGG - Intergenic
1096402544 12:51319219-51319241 CCCAATCCCCAAAAGGCTCAAGG + Intronic
1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG + Intronic
1099746053 12:86706697-86706719 TAGAATCCCCAAATGGCACAAGG + Intronic
1102921174 12:116792794-116792816 CAGAGACCCCTAATGGCTCACGG + Intronic
1103113517 12:118304337-118304359 TAGAACCCTCAAAGGTCTCAGGG + Intronic
1106219816 13:27736462-27736484 CAAAACCCTCAAAAGGCACAAGG + Intergenic
1107214430 13:37899720-37899742 CAGAAACCCAAAAAGGCCAATGG + Intergenic
1108356709 13:49634922-49634944 CAGCACCCCGGGAAGGCTCAGGG - Intergenic
1109258345 13:60111658-60111680 CACCACCCCCCAAACGCTCATGG + Intronic
1110519326 13:76456713-76456735 CAGAACCCAGGAAAGGCTAAGGG + Intergenic
1111489266 13:88949178-88949200 CAGAACACCCACAAAGTTCAGGG + Intergenic
1112387560 13:98954387-98954409 CAGAACCTCCAAATGGACCAAGG + Intronic
1112727613 13:102322416-102322438 TAGGATCCCCAAAAGCCTCAGGG - Intronic
1113948195 13:114056632-114056654 CAGCACCACCAGAAGCCTCACGG - Intronic
1118323698 14:64767880-64767902 CAGACCCCCCACAAGGCCCAGGG + Intronic
1120762693 14:88300031-88300053 CAGAAACCCCAAATAGCTCCCGG + Intronic
1121903931 14:97722422-97722444 AAGATCCCCCATAAGGCTCTGGG - Intergenic
1123932728 15:25179594-25179616 CACCACCCCCACAAGGCTCAAGG - Intergenic
1124245157 15:28063279-28063301 CAAAACCCCAAATAGGCTGAAGG - Intronic
1126512840 15:49500356-49500378 CAGAACCCCACAAAGCCACAGGG + Intronic
1126513085 15:49502333-49502355 CAGAACCCCACAAAGCCACAGGG + Intronic
1126686735 15:51255027-51255049 CAGAACCTCAAACAGGGTCATGG + Intronic
1127615154 15:60677340-60677362 AACAACCCCCAAAAAGCTAAGGG + Intronic
1127827865 15:62720992-62721014 CAGTACCCACAAATGGCTCCAGG - Intronic
1129242819 15:74261678-74261700 CAGAGCCGTCAAACGGCTCAGGG - Intronic
1129379236 15:75154926-75154948 CAGAACACCCAGCAGGGTCAGGG - Intergenic
1131349962 15:91690669-91690691 CAGAACCCTTAAAAGTCTCCTGG + Intergenic
1132233975 15:100205572-100205594 GAGAACCCCAGAGAGGCTCAGGG + Intronic
1132586221 16:706691-706713 CAGACGCCCCAGCAGGCTCAGGG + Intronic
1132676922 16:1124739-1124761 CAGATCCCCCGGAAGGGTCAGGG - Intergenic
1133180121 16:4047983-4048005 CAGAAGCCCCAAGTGGGTCACGG - Intronic
1133532365 16:6666894-6666916 CAGAACCATCAAAATGCTCACGG + Intronic
1133639411 16:7702353-7702375 CAGAATCCCCAAGAAGCTGAGGG + Intronic
1133739375 16:8640037-8640059 CAGAGCCCCCAACAGACTCCAGG + Intronic
1134487134 16:14667548-14667570 CAGCACCCAGAAAAGGCCCAGGG + Intronic
1134816163 16:17207650-17207672 CAGACCACCCAAAAGCCTCAAGG - Intronic
1136867659 16:33769887-33769909 CAGCAACCCCAAAAGGCTTCAGG + Intergenic
1139311616 16:66032679-66032701 CAGGACCCCCAGATGGCTGAGGG + Intergenic
1140306389 16:73806841-73806863 CACTTCCCCCAAAAGGGTCAGGG - Intergenic
1140428705 16:74883367-74883389 CAGAACCCTCACGTGGCTCAGGG - Intronic
1140567420 16:76060505-76060527 CAGACCCCCCAAAAGTGCCATGG + Intergenic
1142146197 16:88493794-88493816 CAGAGCCCTAAAAAGGATCAGGG + Intronic
1142204288 16:88775381-88775403 CAGAACCCCCAAGAGTGTCCGGG + Intronic
1203104503 16_KI270728v1_random:1346316-1346338 CAGCAACCCCAAAAGGCTTCAGG - Intergenic
1203129011 16_KI270728v1_random:1616052-1616074 CAGCAACCCCAAAAGGCTTCAGG + Intergenic
1146039311 17:29435663-29435685 CAGAACCAACAAAAGCCCCATGG - Intronic
1147585096 17:41649538-41649560 CAGAACCCCCAGAATGCAGAGGG + Intergenic
1149353650 17:55817233-55817255 AACAACCCCCAAAAGACTCTTGG - Intronic
1149650128 17:58271470-58271492 CTGCACCCCCAACAGGTTCAGGG + Intronic
1150383587 17:64739996-64740018 AGGAACCCACAAGAGGCTCAGGG + Intergenic
1151384613 17:73747497-73747519 CAGAGCCCCCAGAATGCTCAGGG + Intergenic
1151783179 17:76261206-76261228 CAGAACTCCCAATAGGCCCAAGG - Intergenic
1151915018 17:77111513-77111535 CTGAACCCCAAAAAGCCACAGGG + Intronic
1155071445 18:22320524-22320546 CAGAAACCCCCAAAAGCTCATGG + Intergenic
1157616520 18:48990717-48990739 CAAAAACCCCAAAAGCCTCAAGG - Intergenic
1159909568 18:74132726-74132748 CAGAACTACCAACAGGCTCAGGG + Intronic
1160250763 18:77201861-77201883 CTGAGCCCCCAACAGGCTCTGGG + Intergenic
1161420669 19:4174637-4174659 CAGACCCCCCAAAAGGGTGAAGG - Exonic
1163084102 19:14966862-14966884 CACAGCCCCCAAAAGGCCCCAGG - Intronic
1163328355 19:16619720-16619742 CAGAACCCCCACCAGAGTCAAGG + Intronic
1163545029 19:17936305-17936327 CAGAGGCCCCAAGAGGGTCATGG + Intronic
1163761331 19:19138179-19138201 CAGAATCCCCAGAACGCTTAGGG + Intronic
1167415805 19:49371317-49371339 CAAAATCCCCAAAACTCTCACGG - Intronic
928099889 2:28430799-28430821 CAGAATCCTCCAATGGCTCATGG - Intergenic
933256740 2:80089438-80089460 GAGAACCCCCAAAATGCAAAAGG - Intronic
935447228 2:103169389-103169411 GAGTGACCCCAAAAGGCTCAGGG + Intergenic
937267069 2:120623394-120623416 GAGAACCCCCTACAGGCTGAGGG + Intergenic
942862832 2:180636403-180636425 CAGAACTCCCAATGGGCTCTTGG + Intergenic
942945452 2:181667451-181667473 CAGAAGCCCCCTAAGGATCAGGG + Intronic
945494900 2:210498541-210498563 AAGACCCACCAAAAGGCTCCTGG - Intronic
946393165 2:219428835-219428857 CAGGGCCCCCAACAGACTCAAGG - Intergenic
947390921 2:229638894-229638916 CAAAAACACCAAAAGCCTCAAGG + Intronic
948763961 2:240210145-240210167 CAGAACCCCCCAGAAGGTCAGGG - Intergenic
1168939255 20:1695010-1695032 CAGCACCCTCAGAAGTCTCAGGG - Intergenic
1171383154 20:24748325-24748347 CAGAGCCTCCAAAAGGCAGAGGG + Intergenic
1174376428 20:50129466-50129488 CATAAGCCCCAGAAGGCTCCTGG + Intronic
1174513419 20:51073168-51073190 CAGCTGCCCCAAATGGCTCATGG + Intergenic
1174705283 20:52648840-52648862 CAGAACACCCCAAAATCTCAAGG - Intergenic
1175991933 20:62794109-62794131 CTGAACCCTCAAGAGGCTCAGGG + Intergenic
1178907681 21:36650078-36650100 CATACCCCCAAAGAGGCTCATGG + Intergenic
1179489382 21:41730257-41730279 CACAAACCCTCAAAGGCTCATGG - Intergenic
1181273391 22:21673818-21673840 CTGAGCCCCCAAAAGTCACATGG - Intronic
1182415205 22:30216992-30217014 CAGAAGCCACACAAGGCTGATGG + Intergenic
1183207301 22:36428334-36428356 CAGAGCCTCCAGAAGGATCAAGG - Intergenic
1183345608 22:37305946-37305968 CAGAGTCCCCAAGAAGCTCAGGG + Intronic
950333761 3:12177824-12177846 CAGTGCCCCCAGAAGACTCAGGG + Intronic
950737701 3:15023644-15023666 CAGTACACACAAAAGGCCCAAGG + Intronic
953090343 3:39718612-39718634 CAGAAACCCCAAAAGGGTAAAGG - Intergenic
954157310 3:48693554-48693576 CAGAAACTCCAACAGCCTCATGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956293329 3:67684963-67684985 CATGAAACCCAAAAGGCTCAGGG - Intergenic
958873433 3:99588897-99588919 CAGTGACCCCAAAAGGCTGATGG - Intergenic
958971537 3:100616188-100616210 CAAAACCCATAAAAGTCTCATGG + Intronic
959603291 3:108213252-108213274 CATAACCCCCACATTGCTCAAGG + Intronic
962759114 3:138492639-138492661 CAGGGACCCCAAAAGCCTCAGGG + Intergenic
962829442 3:139127222-139127244 AAGAAACCACAAAAGCCTCAGGG + Intronic
965815693 3:172634429-172634451 CAAAACCCCCAAAAAGGTCATGG + Intronic
968056268 3:195694268-195694290 CATAATCCCCAAAAGGGACAAGG - Intergenic
968130585 3:196190630-196190652 CAGAGCCTGCAAAAGGCTCAGGG + Intergenic
968466493 4:754182-754204 CAGAACCCCCAGCCTGCTCAGGG - Intronic
969216883 4:5730300-5730322 CAGAACCTCCAATAGGCTTTGGG - Intronic
969304380 4:6317445-6317467 TAGAACCCCAGAAAGGCTCTGGG - Intergenic
970618839 4:17796243-17796265 CAGAACCCCCAAAAGACTTGAGG - Intergenic
971048070 4:22828594-22828616 TCGAACCCACAAAAGGCACATGG - Intergenic
972425085 4:38925366-38925388 CACAACCCCAGAAAGGTTCAGGG + Intronic
972739212 4:41874615-41874637 AACAAAACCCAAAAGGCTCAGGG + Intergenic
973136685 4:46716914-46716936 CAGAAGCCACAGAAGACTCAAGG - Intergenic
974684877 4:65215071-65215093 AATAGCCCCAAAAAGGCTCAAGG + Intergenic
974883239 4:67784995-67785017 CAGCACCCCCAAAACTCCCAAGG - Intergenic
977201324 4:94120225-94120247 AAGGGGCCCCAAAAGGCTCAGGG + Intergenic
977890003 4:102298829-102298851 CAGAACCTCAAAAAAGTTCAGGG + Intronic
982375448 4:154685302-154685324 CAAAGTCCCCAAAAGGCTCTGGG - Intronic
984743295 4:183188101-183188123 CAGACACCCAAAAGGGCTCATGG + Intronic
984947217 4:184979173-184979195 CAGGATTCCCAAAAGCCTCATGG + Intergenic
986641682 5:9878098-9878120 GAGAGCCCCCAAATGACTCATGG - Intergenic
987495836 5:18643434-18643456 GAGAACACCCAACAGGCTAATGG + Intergenic
994714761 5:103308104-103308126 CAGAACGCCAAAAAGGTTTATGG + Intergenic
997400525 5:133598460-133598482 CAGAACCTCCCAAGGTCTCAGGG - Intronic
998392568 5:141796814-141796836 CAGAACCCTCAAAAGCCTTTAGG + Intergenic
999785109 5:154883650-154883672 CATAACCCCTGGAAGGCTCATGG - Intergenic
1001443845 5:171767474-171767496 TAGATTCCACAAAAGGCTCATGG - Intergenic
1006417532 6:33913473-33913495 CAAAATCCCCAAAATGCTCGGGG - Intergenic
1007310088 6:40938409-40938431 CAGAACTCCCAGAAGCCTCAGGG - Intergenic
1007780894 6:44254167-44254189 CAAAACCTGCAACAGGCTCATGG + Exonic
1008048901 6:46880107-46880129 CACAACCACCACAAGGCTCTTGG + Intronic
1008138898 6:47809097-47809119 CTAAAGACCCAAAAGGCTCAGGG + Intronic
1009882932 6:69591768-69591790 CAGAATCCCCATAAGGATAAGGG - Intergenic
1012433336 6:99189031-99189053 CTGAACCCCCATCAAGCTCAAGG - Intergenic
1013264504 6:108481410-108481432 CAGGACCCCTAAAAGGGTCTCGG - Intronic
1018312600 6:162526249-162526271 CAGAACCTCCACAAGGCTAAGGG + Intronic
1021507882 7:21405293-21405315 AAGAACCCACAAAAGGCATATGG - Intergenic
1021970008 7:25956626-25956648 CAGTACCTCCAAAAGTCTCTTGG + Intergenic
1022291343 7:29006676-29006698 CAGAACCCCTAAATGTCTCTAGG + Intronic
1024508628 7:50184925-50184947 CAGAAACCCCAAAGGCCTCCAGG - Intergenic
1027685305 7:81273463-81273485 CAGTACTCCCCATAGGCTCATGG - Intergenic
1029949840 7:104571997-104572019 GATAACCACCAAATGGCTCAGGG - Intronic
1034548877 7:151807801-151807823 CAGAAGACCCAAAAGGCATAGGG + Intronic
1040539831 8:48342544-48342566 CAGACACCCCACAGGGCTCATGG - Intergenic
1042250766 8:66754017-66754039 CAGCACTGCCAAAAGACTCAGGG - Intronic
1044679204 8:94760069-94760091 CAGAACCTTGAAAATGCTCAGGG + Intronic
1046145075 8:110147920-110147942 GGGACCCCACAAAAGGCTCAGGG - Intergenic
1047192322 8:122689424-122689446 CAAGACCTCCAAAAGGCTAATGG + Intergenic
1057407759 9:94789019-94789041 TAGAAGCTCCAAAAGGCTCTAGG - Intronic
1058692027 9:107528135-107528157 CTCAACCCTCAAAAGGCCCATGG + Intergenic
1059375556 9:113878158-113878180 CAAACCCCCCAAAATGATCAAGG - Intronic
1062685688 9:137811938-137811960 CAGAGTCCCCGAGAGGCTCAGGG + Intronic
1186740121 X:12508345-12508367 TAAAACCCCCAAAAGGGTAAAGG + Intronic
1187954764 X:24506323-24506345 CAGAACCTCCAAAGGCCTCCGGG + Intronic
1189375389 X:40462531-40462553 CACAACCCCAAAAAGGCTGAGGG + Intergenic
1191880237 X:65838193-65838215 CTGAACCCCCATAAGATTCAGGG - Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1195282142 X:103346721-103346743 CAGACCCCTGAAAACGCTCAAGG - Intergenic
1198051153 X:132954845-132954867 CAGAACCCCTCAAAGCCTCTTGG - Intronic