ID: 1097122959

View in Genome Browser
Species Human (GRCh38)
Location 12:56750073-56750095
Sequence CAGTGGAAACAGCTTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097122956_1097122959 1 Left 1097122956 12:56750049-56750071 CCAAGTATAGAAATGGGTTTTAG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG 0: 1
1: 0
2: 4
3: 35
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097122959 Original CRISPR CAGTGGAAACAGCTTGAGCA AGG Intronic
900861469 1:5235777-5235799 AAGTGGAAAGAGGGTGAGCAGGG - Intergenic
901331829 1:8415548-8415570 CAGTGTAAACAGCCTGACCTTGG - Intronic
902541213 1:17156421-17156443 GTGTGGAAGCAGCCTGAGCAGGG - Intergenic
902592811 1:17487246-17487268 CGGTGGGGACAGCTTGAGCCTGG - Intergenic
902642781 1:17777393-17777415 AAGTGGGAACAGCATGAGCCTGG - Intronic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
903730580 1:25492058-25492080 CAGAAGAAACAGCTTAGGCAAGG + Intronic
904003712 1:27352353-27352375 CCTTGGAAACTGCTTGAGGAGGG + Intronic
904616200 1:31751193-31751215 TAGAGGAAACAGCCTGTGCAAGG - Intronic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907953331 1:59204972-59204994 AAGAGAAAACAGCTTGAACATGG - Intergenic
908241695 1:62194220-62194242 CAGAGGAAACAGCCAGTGCAAGG + Intergenic
908463657 1:64370282-64370304 CAGAGGGAACAGCTAGTGCATGG + Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909685181 1:78339817-78339839 CAGGAGAAAGAGCTAGAGCAAGG + Intronic
909726512 1:78842513-78842535 CAGTGGAAATATTTTGAGAATGG - Intergenic
911864370 1:102997952-102997974 GAGAGGAAACAGCTTGGGAAAGG + Intronic
912251198 1:108014212-108014234 CAGAGGAAACAGCATGTACAAGG - Intergenic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
913427806 1:118753904-118753926 CACTAGGAACTGCTTGAGCAGGG - Intergenic
915404627 1:155650257-155650279 CACTGGTAACACCCTGAGCACGG - Intergenic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
917809339 1:178642338-178642360 CAGTGGAAACAGCAAGACCCCGG - Intergenic
918598887 1:186328786-186328808 TTGTGGAAATAGATTGAGCAAGG - Intronic
919711969 1:200738129-200738151 CAGAGGAACCACCCTGAGCAAGG + Intergenic
920854244 1:209650617-209650639 CTCTGGAACCAGCTTGAGAAAGG + Intronic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921379070 1:214505309-214505331 CAGGAGAAACATCTCGAGCAGGG + Intronic
921558912 1:216633273-216633295 CGGAGGAGACAGCATGAGCAAGG + Intronic
922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG + Intergenic
1062845856 10:704436-704458 CACTGGAAACAACTACAGCATGG - Intergenic
1064809378 10:19177770-19177792 CAATGGTAACAGACTGAGCAGGG + Intronic
1065680676 10:28228425-28228447 TAGTGCAAACAACTTGAACATGG + Intronic
1067307619 10:45079649-45079671 CAGGGGAAACAGCTTAAGATTGG + Intergenic
1067654626 10:48181665-48181687 CAGTAGAAAAACCTTGGGCAAGG + Intronic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1070574212 10:77665279-77665301 CAGAGGAAACAGGGTGAGAAAGG + Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070665205 10:78337770-78337792 CAGTGGGAAAGGCTAGAGCAGGG + Intergenic
1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG + Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1077871774 11:6268966-6268988 CTGAGAAACCAGCTTGAGCAGGG + Intronic
1078617668 11:12880583-12880605 CAGAGGACAAAGCTTGAACAAGG - Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1081543920 11:44056291-44056313 CAGTTGACACAGCTTGTGCTGGG - Exonic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082878329 11:58011565-58011587 CAGTGGAAACAACTTTTACAAGG + Intergenic
1083547183 11:63557814-63557836 CAGAGGGAACAGCGTGAGCCAGG - Intronic
1086723384 11:90149336-90149358 GAGTGGCAACTGCTTCAGCAGGG - Intronic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1089478507 11:118786242-118786264 CAATTAAAACAGCATGAGCACGG - Exonic
1089954981 11:122561941-122561963 CAGTGGAAACAGCCCAGGCAGGG - Intergenic
1091551434 12:1538092-1538114 CAGTGGGAACAGGCTGAGCGTGG + Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1091808310 12:3373627-3373649 CAGTGACAACAGCTTTAGCCTGG + Intergenic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1094661682 12:32475268-32475290 CAGTGGAAACACCATCAGCTTGG - Intronic
1094701235 12:32872621-32872643 CAGGGGAACCAGCCTGGGCAGGG - Intronic
1095484487 12:42671227-42671249 CACTAGTAACAGCTTGAGCCAGG - Intergenic
1095681262 12:44979121-44979143 CAGTGAAAACATCTTTAGGAAGG + Intergenic
1096690893 12:53321216-53321238 GAGTGGAAACAGCTTGGCCCCGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1100107632 12:91196182-91196204 CAGTCAAAAGAGCTTGGGCAGGG + Intergenic
1101128395 12:101663278-101663300 CAGTTAAGACACCTTGAGCATGG - Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101905643 12:108823430-108823452 CAGGGGAAAAAGCTTTAGCGTGG + Intronic
1101945347 12:109132063-109132085 CAGTGGAAAAGGTATGAGCAAGG + Intronic
1104489498 12:129181689-129181711 CAGAGGAAACAGCTTTCACAAGG - Intronic
1104848974 12:131862114-131862136 CAGAGGGAACAGCTAGTGCAAGG + Intergenic
1105366763 13:19772408-19772430 CATTGGAAACAACTGGAGAAAGG + Exonic
1106045709 13:26139298-26139320 CAGAGGAAACAGCTTAGGAATGG - Intronic
1106758486 13:32845334-32845356 CAGGTGATACAGCTTGAGCTGGG - Intergenic
1109617048 13:64848824-64848846 CAGTGGAAACTGCTTTAACAGGG + Intergenic
1111722647 13:91965766-91965788 CAATGGCAACAGCTCAAGCACGG - Intronic
1112410741 13:99161337-99161359 CAGGCGAGACAGCTTGTGCAGGG + Intergenic
1113895959 13:113764601-113764623 CAGTGGAGAAAACTTAAGCAGGG - Intronic
1115505907 14:34093808-34093830 CAGGGGAAATAGCTTGTACAAGG + Intronic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118466934 14:66039495-66039517 CAGAGGAAACAACTGGAGCTTGG - Intergenic
1118816307 14:69316695-69316717 CAGTGGAAGCAAGTTCAGCAAGG + Intronic
1119415125 14:74464812-74464834 CAGTGAAAACATCTTGAGAAAGG + Intergenic
1119825917 14:77656969-77656991 CAGTGGGAACAGGCTGGGCATGG + Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1120866437 14:89299315-89299337 CAGGCAAGACAGCTTGAGCAGGG - Intronic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1122010422 14:98741772-98741794 CAGGGGGAATAGCTTGAGCCTGG + Intergenic
1124425656 15:29560507-29560529 CAGTGGACACAGCAAGGGCAGGG - Intronic
1124998036 15:34743216-34743238 CAAAGGAAATAGCTTGAGCATGG - Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1126939158 15:53746937-53746959 AAGTGGAAACAGTTTGGGAAAGG + Intronic
1127006689 15:54578756-54578778 AGGTGAAAACTGCTTGAGCAGGG + Intronic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127616476 15:60690949-60690971 CTGTGGAAGGAGTTTGAGCAGGG - Intronic
1127920923 15:63493537-63493559 CAGAGGAAACAGCTCGAGCCAGG + Intergenic
1129149925 15:73682227-73682249 AGGGGGAAACAGCTTGGGCAGGG - Intergenic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130900342 15:88202260-88202282 AAGTTGAAAGAGCCTGAGCAAGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1134070135 16:11255677-11255699 CAGTGGACACAGCTAGAAAATGG + Intronic
1135784051 16:25332068-25332090 CAGGCAAAAGAGCTTGAGCAGGG - Intergenic
1135987525 16:27194934-27194956 CAGGCAAAACAGCTTGTGCAGGG + Intergenic
1137753061 16:50880732-50880754 TGTTGGAAACAGCCTGAGCAAGG + Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1138188549 16:54995867-54995889 CAGTGAAAACAGGCTGAGCTGGG - Intergenic
1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG + Intergenic
1140113500 16:72022821-72022843 TAGTGGAAACAGACTGAGCCCGG + Intronic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1140947463 16:79783266-79783288 CAGTGGAGACAGCTTGTATAGGG + Intergenic
1141215922 16:82023831-82023853 CAGAGGAAACTGCTGGATCAAGG + Intergenic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143361173 17:6372507-6372529 CAGTGGCAATACCTTCAGCAGGG + Intergenic
1144092180 17:11868041-11868063 AAGTGGAGACCGCTGGAGCAGGG - Intronic
1144767143 17:17739021-17739043 CAGTGGGAACAGCCTGCCCAAGG + Intronic
1146449753 17:32963590-32963612 AAGTGGAAAGAACTTGGGCAGGG - Intergenic
1146808246 17:35882599-35882621 CACTGGACAGAGCTTGAGCATGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1150851020 17:68703816-68703838 CAGTCAAGACAGCTTGTGCAGGG + Intergenic
1152260138 17:79262361-79262383 CAGTGGGATCTGCTTGCGCAGGG - Intronic
1155341611 18:24819352-24819374 CAGTGCAAACAGCCCGTGCAGGG + Intergenic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1156692170 18:39721297-39721319 CAGGTGAAATAGCTTGACCAAGG + Intergenic
1157534573 18:48448883-48448905 CAGAGGAAATAGCTTTGGCAAGG + Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158985027 18:62805649-62805671 CAGTGGAAAAAGGTCGGGCATGG - Intronic
1160171261 18:76557370-76557392 AGGTGGAAACAGCTGAAGCATGG - Intergenic
1160560860 18:79755038-79755060 CAGCGGAGACAGCCTGAGCCTGG - Exonic
1162796914 19:13091854-13091876 CAGCGGAAACAGGGTTAGCAGGG - Intronic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1163229566 19:15991993-15992015 CATTGGAAATTGCTTGAGCAGGG - Intergenic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1165137883 19:33681831-33681853 CAGTGGAAGCAGCTTGAACAAGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1168406634 19:56114070-56114092 CAGTGGCAGCAGTTTGGGCAAGG - Intronic
925972891 2:9119665-9119687 AAATGGAATCAGCTTGGGCACGG + Intergenic
927701914 2:25274501-25274523 CAGAGGAAACAGCACCAGCAAGG - Intronic
928662551 2:33517918-33517940 CTGTGGATATAGCATGAGCAAGG - Intronic
930378488 2:50597391-50597413 AAGAGGAAACAGCTTGAGAGGGG - Intronic
930774163 2:55156486-55156508 CAGGAGAAAAAGCTTCAGCAAGG - Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
932039569 2:68284971-68284993 TAGTGAAAACAGCTTGGGCCTGG - Intronic
933120584 2:78531896-78531918 CAGTGTAAACTGTATGAGCAAGG + Intergenic
933917237 2:87008020-87008042 CACTGGAAACACCTTAACCATGG + Intronic
934005759 2:87761894-87761916 CACTGGAAACACCTTAACCATGG - Intronic
935054767 2:99555994-99556016 CAGTAGCACCAGCTTGAGAAAGG - Intronic
935768715 2:106395994-106396016 CACTGGAAACACCTTAACCATGG - Intronic
935911385 2:107899934-107899956 CACTGGAAACACCTTAACCATGG + Intergenic
936133168 2:109864992-109865014 CACTGGAAACACCTTAACCATGG + Intergenic
936211529 2:110506493-110506515 CACTGGAAACACCTTAACCATGG - Intergenic
936420667 2:112361068-112361090 CACTGGAAACACCTTAACCATGG - Intergenic
937000116 2:118458068-118458090 CAGTAGAAACAGTGTGTGCATGG + Intergenic
937506614 2:122544583-122544605 CAGTGGAAAAAACATGAGCAAGG - Intergenic
938236869 2:129712419-129712441 CAATGGAAACAGCCCCAGCAGGG + Intergenic
940788531 2:158007335-158007357 GAGTGGAAAGAGCTTGGGCTTGG - Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
943186668 2:184615822-184615844 CACTGGAAGCAGCTGCAGCAGGG + Intronic
943848802 2:192689082-192689104 CAGAGAAGACAGCTTGTGCAGGG - Intergenic
944869636 2:203896934-203896956 CAGAGGAAGGAGCTTGAGAAAGG + Intergenic
945433330 2:209791494-209791516 TAGAGGAAACAATTTGAGCAAGG - Intronic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
948057421 2:235019021-235019043 CAGAGGGAACAGCTAGTGCAAGG + Intronic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170784101 20:19452700-19452722 GATTGAAAACAGCTTCAGCAAGG + Intronic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1172315962 20:33954674-33954696 CACTGGACACAGACTGAGCAGGG + Intergenic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174121877 20:48271957-48271979 CAGGGGAAACAGCTTGAGATTGG - Intergenic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174438339 20:50528075-50528097 CAGAGGAAACAGCATATGCAAGG - Intronic
1175118663 20:56702023-56702045 CAGGGGAAACTGCTTGAACCTGG - Intergenic
1175391019 20:58627466-58627488 AAGTGGAAGCGGCTTGAGCAAGG - Intergenic
1176989507 21:15478225-15478247 CAGTTGACACAGCTATAGCATGG - Intergenic
1177120556 21:17132577-17132599 CTGTGGCTAGAGCTTGAGCAGGG + Intergenic
1179992281 21:44954322-44954344 CACTGGAGACAGCCTGTGCACGG - Intronic
1181136616 22:20771436-20771458 TAGTGGTAACAGCTTGTGTATGG - Intronic
1181750156 22:24983646-24983668 CAGAGGGAACAGCTTGCGCTAGG + Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183517424 22:38274891-38274913 CAGAGGGAACAGCTAGTGCAGGG - Intergenic
1185249298 22:49791374-49791396 CACTTGAAGCAGCTTGAACAAGG - Intronic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950825054 3:15809929-15809951 CAGAGGAAACAGCATCTGCAAGG - Intronic
950904948 3:16529786-16529808 AAATGGAAACAGATTGGGCATGG - Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
956731928 3:72204190-72204212 CTGTGGAAACAGCCTGAGCTGGG - Intergenic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957946706 3:87072501-87072523 CAGTGAAAACAGCATGAACTTGG - Intergenic
958642256 3:96820069-96820091 TAGTGGAAACTGACTGAGCAAGG + Intronic
958949602 3:100401801-100401823 CAGTCGAAACGGTTTGAGCGTGG + Exonic
959635548 3:108563409-108563431 CAGTGTAAACAGCTATAACAAGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961630459 3:128294756-128294778 CAGAGGAAACAGCATATGCAAGG + Intronic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962901404 3:139765051-139765073 CAGTGGGATCAGCTTCATCATGG + Intergenic
964421861 3:156511696-156511718 AAGTAGAAAGAGCTTGAGGAAGG - Intronic
965124914 3:164613907-164613929 CAGCTGAAACAGCTTTAGGATGG + Intergenic
965382347 3:168005526-168005548 CAGTGGAATCAGACTGAGCTGGG + Intergenic
965670093 3:171138976-171138998 AAGTGGAAGCTGCATGAGCAAGG + Intronic
967282896 3:187839547-187839569 CAGAGGGAACAGCCTGAGCCAGG + Intergenic
967541005 3:190667786-190667808 CAGCAGTAACAGCTTGACCATGG - Intergenic
968700694 4:2056589-2056611 CAGTGGAAACACCTTAGGCCAGG - Intergenic
968794319 4:2692341-2692363 CAGTGGAAACAACTGAAGCGTGG - Intronic
969067151 4:4495039-4495061 CAGAGGAAAGAGGTTGAGCATGG + Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969836688 4:9848140-9848162 CAGTGGGAACAGTCTAAGCATGG - Intronic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
970957825 4:21835863-21835885 CACAGGAAATAGCTTCAGCAAGG + Intronic
973644946 4:52940887-52940909 CAGTGGAAAGAGCGTGCCCAAGG - Intronic
973846885 4:54921887-54921909 CAGAGAAAACAGCTAAAGCAAGG - Intergenic
974626998 4:64438620-64438642 CAGTGAAAAGACCTTCAGCAAGG - Intergenic
976410115 4:84703612-84703634 CAGAGGGAAGAGCTTGTGCAAGG - Intronic
977220671 4:94334088-94334110 TAGTGCAAATAGCTTGAGCCTGG + Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978964704 4:114726107-114726129 CAGTGGTACCAGCTGCAGCAGGG - Intergenic
980987448 4:139709386-139709408 CAATGGAAACAATTTAAGCATGG + Intronic
981497712 4:145412260-145412282 CAGAAGAAACAGCTAGTGCAAGG - Intergenic
982112125 4:152066347-152066369 CAGAGGAGACAGCATGAACAAGG - Intergenic
982431357 4:155325271-155325293 CAGGGGAAAGTGCTTCAGCAAGG - Intergenic
982449403 4:155534062-155534084 CAGAGGAAACAGGATGAGCTGGG - Intergenic
983521385 4:168712544-168712566 CAATGGAAACAGCTCATGCAAGG - Intronic
984874736 4:184357058-184357080 CACTGGAAACAGGATGAGCTGGG - Intergenic
985788285 5:1911326-1911348 CTGTCTAAACAGCCTGAGCAGGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986728498 5:10617826-10617848 TAGAGGAAACAGCTCAAGCAAGG - Intronic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
988070870 5:26286275-26286297 GAGAGGAGACAGCTTGTGCAGGG + Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
991598391 5:68327899-68327921 CATTGGAAGCAGATTGGGCAGGG - Intergenic
992570320 5:78048738-78048760 CAGAGAAAACAACTTCAGCAAGG - Intronic
995060426 5:107807146-107807168 CAGAGGAAACAGCTAGAACAAGG + Intergenic
997844693 5:137275983-137276005 CAGTGTGAACAGCCTGGGCAGGG - Intronic
999227907 5:150042514-150042536 CAGAGGGAACAGCTCGAACAGGG + Intronic
1001106717 5:168860786-168860808 CAGGGGAAACAGCTTAAGAATGG - Intronic
1001290330 5:170452822-170452844 CAGAGGAAACAGCGTGATTAAGG + Intronic
1003411640 6:5868782-5868804 CAGTCAAAACAGATTGACCAAGG + Intergenic
1003462125 6:6339361-6339383 CAGGGGAAATAGCTTGAACCTGG - Intergenic
1003581041 6:7341193-7341215 CAGTTGACACAGCTTGTGCTAGG + Intronic
1005637919 6:27768773-27768795 CAGCGGGCACAGCTTGAGAAAGG - Intergenic
1006278033 6:33021953-33021975 CAGTGGAAACTTATTGAGTAAGG - Intergenic
1006339986 6:33441585-33441607 CAGTGGACCCAGCTTCAGGAGGG - Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006756674 6:36422323-36422345 CAGAGGGAGCAGCTTGTGCAAGG - Intronic
1006878361 6:37317831-37317853 CAGAGGAAACAGCCAGTGCAGGG + Intronic
1007787954 6:44292252-44292274 CAGAGGGAACAACTTGAGCAAGG - Intronic
1008062849 6:47016648-47016670 TAATGGAAACAGCTTGTGAAGGG + Exonic
1008080334 6:47188134-47188156 GATTGGAAACAGATTGTGCAGGG + Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010802356 6:80191355-80191377 CAGTGGACACAGCTAGTGCTTGG + Intronic
1011834903 6:91420223-91420245 CACTGGAAACTACTAGAGCAGGG + Intergenic
1014167129 6:118238149-118238171 TAATAGAAACACCTTGAGCAGGG - Intronic
1016642509 6:146365659-146365681 CAGAGGGGACAGCTAGAGCAAGG - Intronic
1017664448 6:156706075-156706097 TAGAGGAAACAGCTTGTTCATGG + Intergenic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1020044486 7:5031061-5031083 CAGTAGAAACAGATCTAGCATGG - Intronic
1020719217 7:11720446-11720468 CAGTAGAAAGAGATTAAGCATGG - Intronic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1022333291 7:29399956-29399978 CACTGGCAACAGCTCCAGCAGGG + Intronic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1024166010 7:46731084-46731106 CAGTGGGACCAACTTGAGGATGG + Intronic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029202869 7:98850800-98850822 CAGTGGCAACTGCTGGGGCAGGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031431918 7:121682324-121682346 CAGTGCAAACTGATTGAGGAAGG + Intergenic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033530365 7:142256870-142256892 CAGAGGCAACAGCTGCAGCATGG + Intronic
1035602436 8:904626-904648 CCGTGGCATCAGCCTGAGCAGGG - Intergenic
1035943527 8:3931745-3931767 CAGAGGAAACAAGGTGAGCAAGG + Intronic
1038483027 8:27914749-27914771 GAGTGGACAAAGCCTGAGCAGGG - Intronic
1038633061 8:29263456-29263478 CAGAGGAAATAACTTGAGCCAGG - Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1043368765 8:79566161-79566183 CAGTGGAAAGAACAAGAGCAAGG - Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044170926 8:89050389-89050411 CAGTGGCTACAGCTCTAGCAAGG - Intergenic
1044283595 8:90385132-90385154 CAGAAGGATCAGCTTGAGCAAGG - Intergenic
1044327794 8:90879437-90879459 AAGTGAAAACAGGTTGGGCATGG - Intronic
1047190692 8:122676540-122676562 CACAGGAAACAGACTGAGCAAGG - Intergenic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1048136020 8:131747120-131747142 CACTGGGGACTGCTTGAGCAGGG + Intergenic
1048258194 8:132922272-132922294 AAGAAGAAACAGCTTGAACATGG + Intronic
1048332209 8:133478611-133478633 CAGTGGGGACAGCCTGAGCAGGG - Intronic
1049169121 8:141147502-141147524 TTGTGGAAACAGCGTGTGCAAGG - Intronic
1049180943 8:141221882-141221904 CCGTGGAGACAACCTGAGCAGGG - Intronic
1050247558 9:3706923-3706945 CAGGGAGAACAGGTTGAGCACGG + Intergenic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1057513779 9:95703695-95703717 GAGTGGAGACAGCTTCAGCTTGG + Intergenic
1059135227 9:111799682-111799704 CAGCTGAAACAATTTGAGCAGGG - Intergenic
1059426923 9:114227052-114227074 TATAGGAAACAGCTTGAGCCAGG + Intronic
1059522836 9:114959879-114959901 CAGGTTAAACAGCTTGACCAAGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061729672 9:132604083-132604105 CAGTGGAAACTGGTTTTGCATGG + Intronic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1062537522 9:137027513-137027535 CAGTGGCGAGAGCATGAGCAAGG + Exonic
1185701588 X:2234999-2235021 AAGTGGAAACAGGCTGGGCATGG - Intronic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1186713636 X:12227269-12227291 TAGTGGAAACAGCTCTTGCATGG + Intronic
1186785822 X:12955206-12955228 CAGAGGACCCAGCTGGAGCAGGG + Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1191079158 X:56490496-56490518 AAATGGAAAGAGCTTGTGCATGG - Intergenic
1191901377 X:66044093-66044115 CAGTGGAAAGAGCATGGGAATGG + Intergenic
1192268777 X:69558947-69558969 CCGAGGAAACAGCATGTGCAAGG + Intergenic
1192552684 X:72066666-72066688 CAATGGGAACATCTTGAGCATGG + Intergenic
1196188489 X:112770765-112770787 CAGTGGGACAAGATTGAGCATGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197986256 X:132269306-132269328 CAGTGCTAACAACTTGAGCAGGG - Intergenic
1199107258 X:143884510-143884532 CCATTGAAACAGCTAGAGCATGG + Intergenic
1199458844 X:148060367-148060389 CAGGCAAAAGAGCTTGAGCAGGG + Intergenic
1200051008 X:153431716-153431738 CAGTGGGAGGGGCTTGAGCAAGG - Intergenic
1200283581 X:154799839-154799861 CAGAGGAAACATCTGCAGCAGGG + Intronic
1200283838 X:154802116-154802138 CAGAGGGAACAGCCTGTGCACGG - Intronic
1200833794 Y:7713046-7713068 CTGTGGAAACAGCTTCAAGATGG + Intergenic