ID: 1097125778

View in Genome Browser
Species Human (GRCh38)
Location 12:56773845-56773867
Sequence CAGGTAGAGCCACATAGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097125778_1097125783 -9 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125783 12:56773859-56773881 CTCTACCTGGCGGCCTTCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 74
1097125778_1097125786 13 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125786 12:56773881-56773903 GCCTGTACTACCTTCTGCACTGG 0: 2
1: 2
2: 0
3: 13
4: 395
1097125778_1097125789 20 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125789 12:56773888-56773910 CTACCTTCTGCACTGGTACCGGG 0: 2
1: 2
2: 0
3: 10
4: 117
1097125778_1097125788 19 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125778_1097125791 25 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125791 12:56773893-56773915 TTCTGCACTGGTACCGGGAGAGG 0: 2
1: 1
2: 1
3: 5
4: 83
1097125778_1097125782 -10 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125782 12:56773858-56773880 GCTCTACCTGGCGGCCTTCGTGG 0: 1
1: 0
2: 1
3: 8
4: 81
1097125778_1097125792 29 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125792 12:56773897-56773919 GCACTGGTACCGGGAGAGGCAGG 0: 2
1: 1
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097125778 Original CRISPR CAGGTAGAGCCACATAGTGA GGG (reversed) Exonic