ID: 1097125779

View in Genome Browser
Species Human (GRCh38)
Location 12:56773846-56773868
Sequence CCAGGTAGAGCCACATAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097125779_1097125788 18 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125779_1097125783 -10 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125783 12:56773859-56773881 CTCTACCTGGCGGCCTTCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 74
1097125779_1097125789 19 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125789 12:56773888-56773910 CTACCTTCTGCACTGGTACCGGG 0: 2
1: 2
2: 0
3: 10
4: 117
1097125779_1097125791 24 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125791 12:56773893-56773915 TTCTGCACTGGTACCGGGAGAGG 0: 2
1: 1
2: 1
3: 5
4: 83
1097125779_1097125786 12 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125786 12:56773881-56773903 GCCTGTACTACCTTCTGCACTGG 0: 2
1: 2
2: 0
3: 13
4: 395
1097125779_1097125792 28 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125792 12:56773897-56773919 GCACTGGTACCGGGAGAGGCAGG 0: 2
1: 1
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097125779 Original CRISPR CCAGGTAGAGCCACATAGTG AGG (reversed) Exonic