ID: 1097125782 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:56773858-56773880 |
| Sequence | GCTCTACCTGGCGGCCTTCG TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 91 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 8, 4: 81} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1097125778_1097125782 | -10 | Left | 1097125778 | 12:56773845-56773867 | CCCTCACTATGTGGCTCTACCTG | 0: 1 1: 0 2: 1 3: 19 4: 151 |
||
| Right | 1097125782 | 12:56773858-56773880 | GCTCTACCTGGCGGCCTTCGTGG | 0: 1 1: 0 2: 1 3: 8 4: 81 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1097125782 | Original CRISPR | GCTCTACCTGGCGGCCTTCG TGG | Exonic | ||