ID: 1097125783 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:56773859-56773881 |
Sequence | CTCTACCTGGCGGCCTTCGT GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 78 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 2, 4: 74} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1097125778_1097125783 | -9 | Left | 1097125778 | 12:56773845-56773867 | CCCTCACTATGTGGCTCTACCTG | 0: 1 1: 0 2: 1 3: 19 4: 151 |
||
Right | 1097125783 | 12:56773859-56773881 | CTCTACCTGGCGGCCTTCGTGGG | 0: 1 1: 0 2: 1 3: 2 4: 74 |
||||
1097125779_1097125783 | -10 | Left | 1097125779 | 12:56773846-56773868 | CCTCACTATGTGGCTCTACCTGG | 0: 1 1: 0 2: 2 3: 22 4: 255 |
||
Right | 1097125783 | 12:56773859-56773881 | CTCTACCTGGCGGCCTTCGTGGG | 0: 1 1: 0 2: 1 3: 2 4: 74 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1097125783 | Original CRISPR | CTCTACCTGGCGGCCTTCGT GGG | Exonic | ||