ID: 1097125784

View in Genome Browser
Species Human (GRCh38)
Location 12:56773864-56773886
Sequence ACAGGCCCACGAAGGCCGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097125784_1097125786 -6 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125786 12:56773881-56773903 GCCTGTACTACCTTCTGCACTGG 0: 2
1: 2
2: 0
3: 13
4: 395
1097125784_1097125792 10 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125792 12:56773897-56773919 GCACTGGTACCGGGAGAGGCAGG 0: 2
1: 1
2: 0
3: 17
4: 201
1097125784_1097125788 0 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125784_1097125793 13 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125793 12:56773900-56773922 CTGGTACCGGGAGAGGCAGGTGG 0: 1
1: 1
2: 1
3: 51
4: 320
1097125784_1097125789 1 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125789 12:56773888-56773910 CTACCTTCTGCACTGGTACCGGG 0: 2
1: 2
2: 0
3: 10
4: 117
1097125784_1097125791 6 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125791 12:56773893-56773915 TTCTGCACTGGTACCGGGAGAGG 0: 2
1: 1
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097125784 Original CRISPR ACAGGCCCACGAAGGCCGCC AGG (reversed) Exonic