ID: 1097125785

View in Genome Browser
Species Human (GRCh38)
Location 12:56773872-56773894
Sequence AAGGTAGTACAGGCCCACGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097125785_1097125792 2 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125792 12:56773897-56773919 GCACTGGTACCGGGAGAGGCAGG 0: 2
1: 1
2: 0
3: 17
4: 201
1097125785_1097125789 -7 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125789 12:56773888-56773910 CTACCTTCTGCACTGGTACCGGG 0: 2
1: 2
2: 0
3: 10
4: 117
1097125785_1097125791 -2 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125791 12:56773893-56773915 TTCTGCACTGGTACCGGGAGAGG 0: 2
1: 1
2: 1
3: 5
4: 83
1097125785_1097125788 -8 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125785_1097125793 5 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125793 12:56773900-56773922 CTGGTACCGGGAGAGGCAGGTGG 0: 1
1: 1
2: 1
3: 51
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097125785 Original CRISPR AAGGTAGTACAGGCCCACGA AGG (reversed) Exonic