ID: 1097125788

View in Genome Browser
Species Human (GRCh38)
Location 12:56773887-56773909
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097125779_1097125788 18 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125784_1097125788 0 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125778_1097125788 19 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125785_1097125788 -8 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904618453 1:31762332-31762354 AGTATCCTCTGCACTGCTACTGG - Intronic
905022510 1:34827620-34827642 TCTACCATCTGCACGTGTACAGG + Intronic
910896484 1:92075339-92075361 ACCACCTCCTGCTCTGGGACTGG - Exonic
915922236 1:159985071-159985093 ACTTCCTTCTGTCCTGGTGCAGG - Intergenic
920812951 1:209304216-209304238 CCTACCTTCTCCAATGGAACTGG - Intergenic
1067686944 10:48471342-48471364 ACTGCCTTCTGCGCTGCCACTGG + Intronic
1081258626 11:40930125-40930147 ACTACCTTCTGGACTAGAAGTGG - Intronic
1085400833 11:76234615-76234637 ACTACCTTCCGCTCTCCTACGGG + Intergenic
1086506769 11:87513274-87513296 ACTAAATACTGCACTGATACAGG - Intergenic
1088602459 11:111493379-111493401 CCTACCTTCTGCCCTTGTGCAGG - Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097134599 12:56841219-56841241 ACTACCTTCTGCGCTGGTAGTGG - Intergenic
1097146261 12:56941426-56941448 ACTACCTTCTGTGCTCATACTGG - Intergenic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097593724 12:61602452-61602474 ACTACCTTCTGCTTTGCTTCTGG + Intergenic
1098496467 12:71141576-71141598 ACTACCTGCTGCACAAGTGCTGG - Intronic
1107056055 13:36104737-36104759 ACTTTCTTCTTCAATGGTACAGG - Intronic
1111372839 13:87338984-87339006 GCTATTTTCTGTACTGGTACAGG + Intergenic
1114201880 14:20528888-20528910 ACTACCTCCTGCTCTGAGACTGG - Intergenic
1117090838 14:52248358-52248380 ACTACTTTCAGCACTGGCAATGG - Intergenic
1120836446 14:89042096-89042118 ACTCCCTTCTGCCCAGCTACAGG - Intergenic
1130092990 15:80836820-80836842 ACTTCCTACTGCTCTGGTCCTGG - Intronic
1132568080 16:632217-632239 ACCACCATCTGCACTGGTCCCGG - Intronic
1134020898 16:10920784-10920806 TCTAGTTTCTGCACTGGTACCGG + Intronic
1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG + Intronic
1149682250 17:58514614-58514636 CCTCCCTTCTGCACTCGTGCGGG - Intronic
1156470612 18:37375361-37375383 CCTAGCTGCTGCCCTGGTACTGG - Intronic
1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG + Intergenic
1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG + Intergenic
928467270 2:31533680-31533702 ACTGCCTTCTGCACTGGAAATGG - Exonic
931049407 2:58393790-58393812 AAAACCATCTGTACTGGTACAGG - Intergenic
935516836 2:104050826-104050848 ACTAAATTCTGCACTTATACAGG - Intergenic
937261970 2:120592257-120592279 ACAACCTGCTGCAAAGGTACTGG - Intergenic
938642460 2:133295198-133295220 ACCACCTGCTTCACTGGTACTGG - Intronic
938814193 2:134883046-134883068 TCTACCTTCTGGACAGGTGCTGG - Intronic
939651378 2:144766897-144766919 ACTATCCTCTGCACAGGTAGGGG + Intergenic
941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG + Intronic
944655542 2:201873545-201873567 ACTATCTTCTGCCATGGGACAGG - Intronic
947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG + Intronic
1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG + Intergenic
1178783209 21:35626166-35626188 AATACCTTATGCTCTGGTTCTGG + Intronic
1182532581 22:30971685-30971707 ACTACCACCAGCACTGTTACTGG + Intergenic
952639077 3:35569568-35569590 ATTGGCTTCTGCCCTGGTACTGG - Intergenic
957060973 3:75481106-75481128 ACTACCTCCTGCACTTGTCGGGG - Intergenic
959253032 3:103972510-103972532 TCTACCTTCTGCACTGGGGCAGG + Intergenic
959275767 3:104276155-104276177 ACTACTTTCTTAATTGGTACTGG + Intergenic
963264378 3:143226225-143226247 GCTTCCTTCTGCACTTTTACTGG - Intergenic
964384225 3:156130218-156130240 ATTACCTTCTGCACTGGACATGG + Intronic
989323665 5:40165514-40165536 CCTAGCTCCTGCACTGGCACTGG - Intergenic
991952517 5:71960349-71960371 TGTACCTCATGCACTGGTACTGG - Intergenic
992564692 5:77985849-77985871 ACTACCTTCTGGGCTGTTCCCGG + Intergenic
993356884 5:86924362-86924384 ACTACTTTATGCATTTGTACAGG - Intergenic
993416748 5:87642804-87642826 ACTACCTTGAGCACTGGTTTTGG - Intergenic
994207979 5:97057286-97057308 ACCACCTCCTGCTCTGGGACTGG - Intergenic
998385688 5:141756037-141756059 ACCACCGTCTGTACTGGGACAGG + Intergenic
1005310041 6:24550307-24550329 CCTACCTTGTGCACAGGCACCGG - Intronic
1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG + Intergenic
1007952122 6:45881807-45881829 ACAACCTTCTGCACTTGAAGAGG - Intergenic
1011428546 6:87258068-87258090 ACTACCTTCTTGACTGACACTGG - Exonic
1016539836 6:145151967-145151989 TCTCTCTTCTGCACAGGTACTGG - Intergenic
1018384342 6:163289677-163289699 ACTCCCTCCTGGACTAGTACAGG - Intronic
1049707542 8:144049884-144049906 ACTACCGTCCGCACAGGTACTGG + Intergenic
1050200363 9:3138963-3138985 ACTACTTTCAACACTGGTGCTGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1060713698 9:125898551-125898573 ACTAAATTCTGAACTGGTTCAGG + Intronic
1061127085 9:128683946-128683968 ACCACCTCCTGCTCTGGGACCGG + Exonic
1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG + Intronic
1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG + Intergenic
1188409952 X:29859427-29859449 CATACCTTCTGCACTTGTAATGG + Intronic
1188832533 X:34917527-34917549 GCTACTTTCTGGGCTGGTACGGG + Intergenic
1188993046 X:36847519-36847541 GCTACTTTCTGGGCTGGTACTGG - Intergenic
1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG + Exonic
1193700518 X:84755186-84755208 ACCACCTCCTGCTCTGGGACCGG + Intergenic
1200079071 X:153566608-153566630 ACCACCCTCTGCAGTGGGACTGG + Intronic