ID: 1097125788

View in Genome Browser
Species Human (GRCh38)
Location 12:56773887-56773909
Sequence ACTACCTTCTGCACTGGTAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097125784_1097125788 0 Left 1097125784 12:56773864-56773886 CCTGGCGGCCTTCGTGGGCCTGT 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125779_1097125788 18 Left 1097125779 12:56773846-56773868 CCTCACTATGTGGCTCTACCTGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125778_1097125788 19 Left 1097125778 12:56773845-56773867 CCCTCACTATGTGGCTCTACCTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64
1097125785_1097125788 -8 Left 1097125785 12:56773872-56773894 CCTTCGTGGGCCTGTACTACCTT 0: 2
1: 0
2: 0
3: 5
4: 74
Right 1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG 0: 3
1: 0
2: 1
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097125788 Original CRISPR ACTACCTTCTGCACTGGTAC CGG Exonic