ID: 1097132021

View in Genome Browser
Species Human (GRCh38)
Location 12:56818621-56818643
Sequence GTCATTGCTCAGAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097132010_1097132021 29 Left 1097132010 12:56818569-56818591 CCATGTGGGACAACAGCAGCTGG No data
Right 1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG No data
1097132009_1097132021 30 Left 1097132009 12:56818568-56818590 CCCATGTGGGACAACAGCAGCTG No data
Right 1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097132021 Original CRISPR GTCATTGCTCAGAGAGGGGA GGG Intergenic
No off target data available for this crispr