ID: 1097134599

View in Genome Browser
Species Human (GRCh38)
Location 12:56841219-56841241
Sequence ACTACCTTCTGCGCTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097134599_1097134603 -8 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134603 12:56841234-56841256 AAGGTAGTACAGGCCCACGAGGG No data
1097134599_1097134605 1 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134605 12:56841243-56841265 CAGGCCCACGAGGGCTATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 70
1097134599_1097134610 18 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134610 12:56841260-56841282 TCAGGGAGAGTCCCATGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 204
1097134599_1097134604 0 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134604 12:56841242-56841264 ACAGGCCCACGAGGGCTATCAGG 0: 1
1: 0
2: 0
3: 2
4: 82
1097134599_1097134602 -9 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134602 12:56841233-56841255 GAAGGTAGTACAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 8
4: 90
1097134599_1097134608 13 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126
1097134599_1097134609 17 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134609 12:56841259-56841281 ATCAGGGAGAGTCCCATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1097134599_1097134611 19 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097134599 Original CRISPR ACTACCTTCTGCGCTGGTAG TGG (reversed) Intergenic