ID: 1097134599

View in Genome Browser
Species Human (GRCh38)
Location 12:56841219-56841241
Sequence ACTACCTTCTGCGCTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097134599_1097134605 1 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134605 12:56841243-56841265 CAGGCCCACGAGGGCTATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 70
1097134599_1097134609 17 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134609 12:56841259-56841281 ATCAGGGAGAGTCCCATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1097134599_1097134608 13 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126
1097134599_1097134603 -8 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134603 12:56841234-56841256 AAGGTAGTACAGGCCCACGAGGG No data
1097134599_1097134604 0 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134604 12:56841242-56841264 ACAGGCCCACGAGGGCTATCAGG 0: 1
1: 0
2: 0
3: 2
4: 82
1097134599_1097134611 19 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290
1097134599_1097134610 18 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134610 12:56841260-56841282 TCAGGGAGAGTCCCATGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 204
1097134599_1097134602 -9 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134602 12:56841233-56841255 GAAGGTAGTACAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097134599 Original CRISPR ACTACCTTCTGCGCTGGTAG TGG (reversed) Intergenic
902145490 1:14395447-14395469 TCTACCTTCTGCCCTGGCGGTGG - Intergenic
909561542 1:77014100-77014122 ACCACCTTCTGAGATGGAAGGGG + Intronic
912500280 1:110117113-110117135 TCTTCCTTCTGTGCTGGGAGAGG + Intergenic
1067686944 10:48471342-48471364 ACTGCCTTCTGCGCTGCCACTGG + Intronic
1073934464 10:108614512-108614534 ACTGCCCTCTGCTCTGGAAGAGG + Intergenic
1076671427 10:132122826-132122848 ACAACCTTCTGGGCAGGGAGAGG - Intronic
1081258626 11:40930125-40930147 ACTACCTTCTGGACTAGAAGTGG - Intronic
1085062069 11:73456320-73456342 CCTGTCTTCTGCCCTGGTAGGGG - Intronic
1087688881 11:101297173-101297195 ACTAACATCTGCTCTGGTGGAGG + Intergenic
1091312377 11:134583934-134583956 TCTACATTCTGAGCTGGCAGTGG + Intergenic
1094447302 12:30545903-30545925 ACTACCACCTGTGCTGGTAGAGG + Intergenic
1096158820 12:49359804-49359826 ATTCCCTTCTGGGCTGGGAGTGG - Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097134599 12:56841219-56841241 ACTACCTTCTGCGCTGGTAGTGG - Intergenic
1097146261 12:56941426-56941448 ACTACCTTCTGTGCTCATACTGG - Intergenic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1098072783 12:66694022-66694044 AGTACCGTCTGGGCTGGCAGTGG - Intronic
1100266260 12:92979048-92979070 AGAACTTGCTGCGCTGGTAGGGG - Intergenic
1100401746 12:94236624-94236646 AGTATATTCTGCGATGGTAGAGG + Intronic
1104634219 12:130427592-130427614 TCTCCCTTCTGCTCTGGCAGAGG - Intronic
1104672003 12:130686863-130686885 GCTGCCTTCTGGGCTCGTAGCGG - Intronic
1107633303 13:42364779-42364801 ACTGCCTTCTGTGCTTGTAGAGG + Intergenic
1110181858 13:72626453-72626475 ACTAGCACCTGCTCTGGTAGAGG - Intergenic
1114230285 14:20775272-20775294 AGTACCTTCTCCGCTGATAAGGG + Intergenic
1122289230 14:100670819-100670841 AATTGCTTCTGCGCTGGAAGTGG - Intergenic
1126393500 15:48185837-48185859 ACTACCTTCAGCTGTGTTAGTGG + Intergenic
1132086901 15:98916063-98916085 ACTACATTGTGCGCTGGCAGCGG + Exonic
1138735407 16:59245018-59245040 AATACCGTCTGCTTTGGTAGTGG - Intergenic
1152997064 18:417591-417613 CCTACCTTCTGGGCAGGAAGGGG + Intronic
1161249211 19:3271270-3271292 ACCAGCTTCTGGGCTGGAAGCGG - Intronic
1163886538 19:19970619-19970641 AATACCACCTGCTCTGGTAGAGG + Intergenic
1163887945 19:19984787-19984809 AATACCACCTGCTCTGGTAGAGG - Intergenic
1163967961 19:20765520-20765542 TCTACCACCTGCTCTGGTAGAGG - Intronic
1166441169 19:42816531-42816553 ACTACCATCTGAGCTGTTGGGGG - Intronic
1166460649 19:42985138-42985160 ACTACCATCTGAGCTGTTGGGGG - Intronic
1166477940 19:43145111-43145133 ACTACCATCTGAGCTGTTGGGGG - Intronic
1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG + Intergenic
1168618280 19:57855849-57855871 ACTCCCTTCTGGGCTGGGTGCGG - Intronic
926924991 2:17978253-17978275 ACTAGCTTCTGTGCTTGTATGGG + Intronic
927990895 2:27446177-27446199 TATCCCTTCTGCTCTGGTAGAGG - Intronic
928467270 2:31533680-31533702 ACTGCCTTCTGCACTGGAAATGG - Exonic
934295482 2:91739493-91739515 AAAACCTGCTGCCCTGGTAGAGG - Intergenic
936485828 2:112924927-112924949 ACTTCCTTCTGCTTTTGTAGAGG - Intergenic
939651378 2:144766897-144766919 ACTATCCTCTGCACAGGTAGGGG + Intergenic
942652271 2:178181293-178181315 AATACCTTCTGGGCTGGGTGCGG + Intergenic
948004011 2:234592398-234592420 ACTACCTCCTGGGGTGGCAGTGG - Intergenic
1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG + Intergenic
1180660139 22:17460097-17460119 ACTGCCTTCTGGGCTGGAAGAGG - Intronic
1183622259 22:38981454-38981476 ACAAGCTTCTGTGCAGGTAGGGG + Intronic
954672374 3:52297916-52297938 ACCCCCTTCTCGGCTGGTAGCGG - Intergenic
957060973 3:75481106-75481128 ACTACCTCCTGCACTTGTCGGGG - Intergenic
962253903 3:133857507-133857529 AGGATCTTCTGCCCTGGTAGAGG - Intronic
965782235 3:172297984-172298006 ACTAGCTCCTGCGCGGGAAGGGG - Intronic
968036916 3:195555315-195555337 CCTACCTCCTGCCCTGGGAGGGG - Intergenic
976140008 4:81981364-81981386 ATCACCTTCAGCCCTGGTAGTGG - Intronic
989701018 5:44264966-44264988 GCTACCTTGGGCGCTTGTAGTGG - Intergenic
992564692 5:77985849-77985871 ACTACCTTCTGGGCTGTTCCCGG + Intergenic
996259255 5:121445849-121445871 ACTTCCTTCTGCTCTAGGAGAGG + Intergenic
999212440 5:149901686-149901708 ACTACGTTCTGCTGTGGTTGTGG + Intronic
1005352372 6:24949150-24949172 ACTGCCTTCAGCGCTGTTTGTGG - Intronic
1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG + Intergenic
1007952122 6:45881807-45881829 ACAACCTTCTGCACTTGAAGAGG - Intergenic
1017508858 6:155094167-155094189 TCTACCTTCTCAGCTGGCAGTGG + Intronic
1029464126 7:100714852-100714874 AAGACCTTCTGTGCTGGGAGGGG - Intergenic
1029889937 7:103917490-103917512 ACTGCCTTCAGGGGTGGTAGTGG - Intronic
1048951937 8:139503730-139503752 ACTAACTTCAGCCCTGGTGGTGG + Intergenic
1056074454 9:83024211-83024233 ACTCCCTTCTGTGCTGCTGGAGG - Intronic
1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG + Intronic
1062436265 9:136547829-136547851 ACTCTCTTCTCTGCTGGTAGAGG - Intergenic
1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG + Intergenic
1188734444 X:33695324-33695346 ACTTCCCTCTGTGATGGTAGTGG - Intergenic
1188832533 X:34917527-34917549 GCTACTTTCTGGGCTGGTACGGG + Intergenic
1188993046 X:36847519-36847541 GCTACTTTCTGGGCTGGTACTGG - Intergenic
1189639263 X:43050420-43050442 ACCACCACCTGCTCTGGTAGAGG + Intergenic
1192225110 X:69222355-69222377 CCTAGCTTCTGGGCTGGTAACGG + Intergenic
1194930344 X:99880501-99880523 ACTACCTTTTTGGCTGGGAGTGG - Intergenic
1196643302 X:118089195-118089217 ACTCCTTTCTGCGCTGGGATGGG + Intronic
1201354667 Y:13084234-13084256 TCTACCTCCTCTGCTGGTAGGGG + Intergenic