ID: 1097134602

View in Genome Browser
Species Human (GRCh38)
Location 12:56841233-56841255
Sequence GAAGGTAGTACAGGCCCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097134599_1097134602 -9 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134602 12:56841233-56841255 GAAGGTAGTACAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 8
4: 90
1097134595_1097134602 4 Left 1097134595 12:56841206-56841228 CCACCTGTCTCTCCCACTACCAG 0: 1
1: 0
2: 3
3: 35
4: 460
Right 1097134602 12:56841233-56841255 GAAGGTAGTACAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 8
4: 90
1097134598_1097134602 -8 Left 1097134598 12:56841218-56841240 CCCACTACCAGCGCAGAAGGTAG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1097134602 12:56841233-56841255 GAAGGTAGTACAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 8
4: 90
1097134596_1097134602 1 Left 1097134596 12:56841209-56841231 CCTGTCTCTCCCACTACCAGCGC 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1097134602 12:56841233-56841255 GAAGGTAGTACAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097134602 Original CRISPR GAAGGTAGTACAGGCCCACG AGG Intergenic