ID: 1097134603

View in Genome Browser
Species Human (GRCh38)
Location 12:56841234-56841256
Sequence AAGGTAGTACAGGCCCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097134596_1097134603 2 Left 1097134596 12:56841209-56841231 CCTGTCTCTCCCACTACCAGCGC 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1097134603 12:56841234-56841256 AAGGTAGTACAGGCCCACGAGGG No data
1097134599_1097134603 -8 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134603 12:56841234-56841256 AAGGTAGTACAGGCCCACGAGGG No data
1097134598_1097134603 -7 Left 1097134598 12:56841218-56841240 CCCACTACCAGCGCAGAAGGTAG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1097134603 12:56841234-56841256 AAGGTAGTACAGGCCCACGAGGG No data
1097134595_1097134603 5 Left 1097134595 12:56841206-56841228 CCACCTGTCTCTCCCACTACCAG 0: 1
1: 0
2: 3
3: 35
4: 460
Right 1097134603 12:56841234-56841256 AAGGTAGTACAGGCCCACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097134603 Original CRISPR AAGGTAGTACAGGCCCACGA GGG Intergenic