ID: 1097134608

View in Genome Browser
Species Human (GRCh38)
Location 12:56841255-56841277
Sequence GGCTATCAGGGAGAGTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097134601_1097134608 7 Left 1097134601 12:56841225-56841247 CCAGCGCAGAAGGTAGTACAGGC 0: 1
1: 2
2: 1
3: 5
4: 337
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126
1097134596_1097134608 23 Left 1097134596 12:56841209-56841231 CCTGTCTCTCCCACTACCAGCGC 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126
1097134598_1097134608 14 Left 1097134598 12:56841218-56841240 CCCACTACCAGCGCAGAAGGTAG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126
1097134595_1097134608 26 Left 1097134595 12:56841206-56841228 CCACCTGTCTCTCCCACTACCAG 0: 1
1: 0
2: 3
3: 35
4: 460
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126
1097134599_1097134608 13 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134608 12:56841255-56841277 GGCTATCAGGGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097134608 Original CRISPR GGCTATCAGGGAGAGTCCCA TGG Intergenic