ID: 1097134611

View in Genome Browser
Species Human (GRCh38)
Location 12:56841261-56841283
Sequence CAGGGAGAGTCCCATGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097134599_1097134611 19 Left 1097134599 12:56841219-56841241 CCACTACCAGCGCAGAAGGTAGT 0: 1
1: 0
2: 3
3: 6
4: 69
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290
1097134601_1097134611 13 Left 1097134601 12:56841225-56841247 CCAGCGCAGAAGGTAGTACAGGC 0: 1
1: 2
2: 1
3: 5
4: 337
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290
1097134598_1097134611 20 Left 1097134598 12:56841218-56841240 CCCACTACCAGCGCAGAAGGTAG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290
1097134596_1097134611 29 Left 1097134596 12:56841209-56841231 CCTGTCTCTCCCACTACCAGCGC 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290
1097134606_1097134611 -9 Left 1097134606 12:56841247-56841269 CCCACGAGGGCTATCAGGGAGAG 0: 1
1: 0
2: 1
3: 8
4: 73
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290
1097134607_1097134611 -10 Left 1097134607 12:56841248-56841270 CCACGAGGGCTATCAGGGAGAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1097134611 12:56841261-56841283 CAGGGAGAGTCCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 41
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097134611 Original CRISPR CAGGGAGAGTCCCATGGCAG GGG Intergenic