ID: 1097137046

View in Genome Browser
Species Human (GRCh38)
Location 12:56865644-56865666
Sequence TAGTCACAGAAGTCCCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097137046_1097137047 6 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137047 12:56865673-56865695 CATAGCCAATTTGAACAGCCTGG No data
1097137046_1097137053 29 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137053 12:56865696-56865718 GCCAGGCAAGGTAGAAAGTCAGG No data
1097137046_1097137051 17 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137051 12:56865684-56865706 TGAACAGCCTGGGCCAGGCAAGG No data
1097137046_1097137050 12 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137050 12:56865679-56865701 CAATTTGAACAGCCTGGGCCAGG No data
1097137046_1097137048 7 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137048 12:56865674-56865696 ATAGCCAATTTGAACAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097137046 Original CRISPR TAGTCACAGAAGTCCCACCA AGG (reversed) Intergenic
No off target data available for this crispr