ID: 1097137048

View in Genome Browser
Species Human (GRCh38)
Location 12:56865674-56865696
Sequence ATAGCCAATTTGAACAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097137046_1097137048 7 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137048 12:56865674-56865696 ATAGCCAATTTGAACAGCCTGGG No data
1097137041_1097137048 29 Left 1097137041 12:56865622-56865644 CCTGCTCTGGGTCTGTCTAGTCC No data
Right 1097137048 12:56865674-56865696 ATAGCCAATTTGAACAGCCTGGG No data
1097137045_1097137048 8 Left 1097137045 12:56865643-56865665 CCCTTGGTGGGACTTCTGTGACT No data
Right 1097137048 12:56865674-56865696 ATAGCCAATTTGAACAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097137048 Original CRISPR ATAGCCAATTTGAACAGCCT GGG Intergenic
No off target data available for this crispr