ID: 1097137051

View in Genome Browser
Species Human (GRCh38)
Location 12:56865684-56865706
Sequence TGAACAGCCTGGGCCAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097137045_1097137051 18 Left 1097137045 12:56865643-56865665 CCCTTGGTGGGACTTCTGTGACT No data
Right 1097137051 12:56865684-56865706 TGAACAGCCTGGGCCAGGCAAGG No data
1097137046_1097137051 17 Left 1097137046 12:56865644-56865666 CCTTGGTGGGACTTCTGTGACTA No data
Right 1097137051 12:56865684-56865706 TGAACAGCCTGGGCCAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097137051 Original CRISPR TGAACAGCCTGGGCCAGGCA AGG Intergenic
No off target data available for this crispr