ID: 1097137474

View in Genome Browser
Species Human (GRCh38)
Location 12:56870740-56870762
Sequence GAGATCTGTCACATTCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097137474_1097137476 8 Left 1097137474 12:56870740-56870762 CCACCTTGAATGTGACAGATCTC No data
Right 1097137476 12:56870771-56870793 AAAAAACTTTCCATTATCTCTGG No data
1097137474_1097137477 17 Left 1097137474 12:56870740-56870762 CCACCTTGAATGTGACAGATCTC No data
Right 1097137477 12:56870780-56870802 TCCATTATCTCTGGCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097137474 Original CRISPR GAGATCTGTCACATTCAAGG TGG (reversed) Intergenic
No off target data available for this crispr