ID: 1097144636

View in Genome Browser
Species Human (GRCh38)
Location 12:56931741-56931763
Sequence CCTTGCATGAAGGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097144636_1097144640 0 Left 1097144636 12:56931741-56931763 CCTTCCAGCTCCTTCATGCAAGG 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1097144640 12:56931764-56931786 ATTCCCCAAGTCCTACTGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097144636 Original CRISPR CCTTGCATGAAGGAGCTGGA AGG (reversed) Intronic
900520709 1:3104299-3104321 CCTTGCTGGAAGGTGCTAGAAGG + Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
902643555 1:17781940-17781962 CCATCCATGAAGGAGCCAGATGG + Intronic
903665000 1:25000964-25000986 CCTGGGATGAGGGACCTGGAGGG - Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
905616657 1:39405610-39405632 GACTGCAGGAAGGAGCTGGAAGG + Intronic
907290907 1:53412357-53412379 CCCTGCATGAAGGAGGCAGAAGG + Intergenic
907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG + Intronic
907603078 1:55789368-55789390 CCTTGAATGAAGGAGAGGCAAGG - Intergenic
909649269 1:77955394-77955416 CCTTGGGTGCAGGAGCTGGCAGG + Intronic
911947126 1:104126058-104126080 TCTTTCATGAAGGACCTGGTAGG + Intergenic
912433344 1:109641411-109641433 GCCTGCATGGAGGAGCAGGAAGG + Intergenic
916084913 1:161261424-161261446 TCGTGCACGAAGGAGCTGCAGGG + Intronic
916187976 1:162151752-162151774 CTTTGCATGAATGAGAAGGAAGG + Intronic
916965889 1:169942731-169942753 CCTTGCAGGAAGTAGCCAGAGGG - Intronic
917629353 1:176877568-176877590 CCTTGGGTGATGGAGCTAGATGG + Intronic
919905851 1:202077848-202077870 CCTTGAGGAAAGGAGCTGGAGGG + Intergenic
920872343 1:209805333-209805355 CTTTGCCCGAAGGGGCTGGAGGG - Intronic
920987985 1:210908509-210908531 GCTTGCAAGACGGGGCTGGATGG + Intronic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
1065240881 10:23703028-23703050 CTTTGCATCAAGGAGCCCGAGGG - Intronic
1066758890 10:38736732-38736754 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1067803537 10:49376967-49376989 CCCTACGTGAAGGATCTGGAGGG - Intronic
1069105051 10:64373393-64373415 CCTGGTATAAAGGAGTTGGAAGG - Intergenic
1069470864 10:68688178-68688200 GCTTGAATCAAGGAGGTGGAGGG - Intronic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1070159976 10:73860463-73860485 CCTTGCATGAGGGCTGTGGATGG + Intronic
1071241085 10:83705977-83705999 CTTTGCATGAACCATCTGGAGGG - Intergenic
1072010050 10:91294808-91294830 CCTTTCAGGAAGGACTTGGAGGG + Intergenic
1072123116 10:92421114-92421136 GCCTGCGTGAAGGAGGTGGACGG - Intergenic
1074150561 10:110755921-110755943 CCTAACTTGAAGGGGCTGGATGG - Intronic
1074852896 10:117453081-117453103 CCTTGTAAGAGAGAGCTGGAGGG - Intergenic
1075878990 10:125833764-125833786 CCTTGCAGGAAAGAACTGGCGGG + Exonic
1076570412 10:131429062-131429084 CTTTGGAAGAAGGATCTGGAAGG + Intergenic
1076864222 10:133159507-133159529 CCTGGCTTGAAGGAGCAGCAGGG - Intergenic
1077097823 11:806557-806579 CCTTCCATGTAGGGCCTGGAGGG + Intronic
1079240135 11:18716619-18716641 CTTTGCAAAAAGGAGATGGATGG + Intronic
1079889743 11:26036366-26036388 ACTTGCATGATGGAGATTGATGG - Intergenic
1080328057 11:31101344-31101366 CCTTTCATAATTGAGCTGGAGGG + Intronic
1080610765 11:33901763-33901785 CCTTGAGTGAAGGGGCTGAAAGG + Intergenic
1083144507 11:60748596-60748618 CCTGGCACTAAGGGGCTGGACGG + Intergenic
1083185322 11:61014201-61014223 CCTAGCATGACTGAACTGGAAGG - Intronic
1083632595 11:64103517-64103539 TCTTGCATGACGGAGCTGAGAGG - Exonic
1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG + Intergenic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1085196786 11:74677389-74677411 CCCTGAATGAAGCAGCTGCAAGG - Intergenic
1085804303 11:79620486-79620508 CCATCCATGTAGGAACTGGATGG - Intergenic
1086169338 11:83818015-83818037 CCTAGCATATTGGAGCTGGAAGG + Intronic
1089606238 11:119643178-119643200 CCTTGCCTGATGCACCTGGAGGG + Intronic
1091288099 11:134420111-134420133 CTGTGGAGGAAGGAGCTGGAGGG - Intergenic
1093078881 12:14787075-14787097 GCTTTCATGAAAGAGATGGAAGG - Exonic
1093407170 12:18818678-18818700 CCTTGGATGAATAAGATGGAAGG - Intergenic
1094406945 12:30126286-30126308 CTTTGCATGAAGATGCTGAAAGG + Intergenic
1096537524 12:52284880-52284902 CCATGCATGAAGGAGCTGAATGG + Intronic
1096724927 12:53553892-53553914 CCTGACAGGTAGGAGCTGGATGG - Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1097247444 12:57614323-57614345 TCTTGCAAGAAATAGCTGGAGGG - Exonic
1099525773 12:83718091-83718113 CATTGCAGGAAGGACCTGGTGGG + Intergenic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1103699924 12:122843801-122843823 CCTTGCAGAAGGGAGTTGGAGGG - Intronic
1104519382 12:129458882-129458904 CCTTGGATGTCAGAGCTGGAAGG + Intronic
1105014195 12:132776259-132776281 CAGGGCAGGAAGGAGCTGGAGGG - Intronic
1105405972 13:20132967-20132989 CCATTCATGAAGTATCTGGAGGG - Intergenic
1105516133 13:21092405-21092427 CCTTTCATGAAGGGGCAGCAAGG + Intergenic
1106083131 13:26517108-26517130 CCAAGGATTAAGGAGCTGGAAGG - Intergenic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1108484149 13:50908084-50908106 CTTTGCAGGACGAAGCTGGATGG - Intergenic
1109727113 13:66356274-66356296 ACTTCCATGAAGGTGCTGCAGGG - Intronic
1113475753 13:110579865-110579887 CAATGCCTGAAGGAGCTGAAAGG - Intergenic
1114418639 14:22561063-22561085 CATTGCATGAAGGAGGTGGGTGG - Intergenic
1115312393 14:31992670-31992692 CCTTGCATAAAAGATCTGGCAGG - Intergenic
1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG + Intronic
1119553201 14:75532117-75532139 CCTTGCATTAAGTAACTTGATGG + Intronic
1122548009 14:102535466-102535488 CCTTGCAGGAAGGAACAGGGTGG - Intergenic
1122772151 14:104102310-104102332 CCTGGCATGGTGGAGCTGAAGGG - Intronic
1123422686 15:20144920-20144942 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123442320 15:20301429-20301451 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1123531912 15:21151460-21151482 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1125921605 15:43528648-43528670 CCTGGCCTGAAGGAGCTGAGAGG + Exonic
1126322530 15:47440568-47440590 TCATGCATGAGGGAGATGGAAGG + Intronic
1130226949 15:82066397-82066419 CAGTGCAAGATGGAGCTGGAGGG - Intergenic
1130662269 15:85840161-85840183 CCCTCCACGAAGAAGCTGGAAGG + Intergenic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1134678352 16:16106200-16106222 GCTTGCATGAAGGAGCAGTCAGG + Intronic
1135002162 16:18786026-18786048 TCTTGCATGAAAGCGATGGAGGG + Intronic
1135468950 16:22712212-22712234 CCTTGAAGGGTGGAGCTGGAAGG + Intergenic
1136718897 16:32304121-32304143 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136723918 16:32342477-32342499 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136773019 16:32857837-32857859 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1136837270 16:33510385-33510407 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136842246 16:33548521-33548543 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136897596 16:34003682-34003704 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1137471757 16:48766785-48766807 ACTTTCATAATGGAGCTGGAAGG + Intergenic
1137733935 16:50710550-50710572 TCTTGCATGTGGCAGCTGGAAGG - Exonic
1137966697 16:52941802-52941824 GCTTCCATGATGGCGCTGGAAGG + Intergenic
1138897801 16:61229795-61229817 CCTTGCAACAAGAAGCTAGAGGG - Intergenic
1139081127 16:63522650-63522672 CCAGGCAGGAAGGAGCGGGATGG + Intergenic
1141212321 16:81993105-81993127 CCCTGCATAAAGGAGCAGGTGGG + Exonic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141902844 16:87003805-87003827 CATTGCAAGAAGGTGCTGGAGGG + Intergenic
1203002513 16_KI270728v1_random:175288-175310 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203007534 16_KI270728v1_random:213650-213672 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203075444 16_KI270728v1_random:1119947-1119969 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203123554 16_KI270728v1_random:1558604-1558626 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203134118 16_KI270728v1_random:1711694-1711716 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203147446 16_KI270728v1_random:1810664-1810686 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1203152411 16_KI270728v1_random:1848818-1848840 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1142890087 17:2937540-2937562 ACGTGCAGGAGGGAGCTGGAAGG + Intronic
1144493885 17:15735340-15735362 TCTTGCAGGATGGAGATGGATGG + Exonic
1146912149 17:36655683-36655705 CTTGGCATGAAGGTGGTGGAGGG + Intergenic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147968398 17:44206687-44206709 CCCTGCAGGAAGGAGCTGCCTGG - Exonic
1148451087 17:47778284-47778306 CCTTGCAGGAAGGAGCAGCGCGG + Intergenic
1148961672 17:51398303-51398325 CCTTGTAAGAAGGAGCCGAAAGG + Intergenic
1149296430 17:55265767-55265789 CCTTTCATGGAGGAGGAGGAAGG - Intronic
1150463437 17:65371914-65371936 CCTGGCATCAGGGAGCTGGGAGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151342406 17:73480436-73480458 CCCAGGAAGAAGGAGCTGGATGG + Intronic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1152268964 17:79312682-79312704 ATGTGCATGAAGGAGCTGGAGGG - Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1164260534 19:23565211-23565233 CCTTGCAGGAAGGGTCAGGAAGG + Intronic
1167411781 19:49348442-49348464 ACTAGCATAAAGGAACTGGAAGG - Intronic
1168351503 19:55678730-55678752 TCTGACATGAGGGAGCTGGATGG - Exonic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
926756855 2:16243472-16243494 CCTTGAATCAAGGAGCTGCTTGG + Intergenic
927860891 2:26559260-26559282 CCATGCATGATGGAGATGGCTGG + Intergenic
928624082 2:33121631-33121653 CATTCCATGGAGGAGCTGGCTGG + Intronic
929000845 2:37345274-37345296 CCTTGGATGAAGCAGCGGGGGGG - Intronic
929049365 2:37822708-37822730 CATGGGATGAAGGAGCTGGAGGG - Intergenic
929277974 2:40045755-40045777 TCCTTCATGAAGTAGCTGGAGGG - Intergenic
930193797 2:48488246-48488268 CCGTGGATGAAGGAGGTGAAAGG - Intronic
932142848 2:69294874-69294896 CCCTGCAGGAGGGTGCTGGAAGG - Intergenic
932305945 2:70704437-70704459 TCTTTCAGGGAGGAGCTGGAAGG - Exonic
933335380 2:80951266-80951288 ACTTGCATGGCTGAGCTGGAAGG - Intergenic
933736612 2:85500319-85500341 CTGTGCATGAAGGAGCAGGCAGG + Intergenic
934322217 2:91981072-91981094 CCTGGCATGGAGTAGCTGGGCGG - Intergenic
934670431 2:96208935-96208957 GCATGCATGAAGGGGCAGGAGGG - Intergenic
935925591 2:108065185-108065207 CTTTCCAGGAAGCAGCTGGATGG + Intergenic
936042199 2:109158507-109158529 CCTTGGCTGGGGGAGCTGGATGG + Intronic
937058758 2:118965838-118965860 CCTTGCAGGAAGGACCAGCAGGG - Intronic
937936573 2:127250055-127250077 GCTTTCATGAAAGAGATGGAAGG + Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
940982065 2:160014836-160014858 GGATGCATGAAGGAGCTGTATGG - Intronic
942648566 2:178142794-178142816 CCTTGAAAGAATGAGGTGGAAGG + Intergenic
942832238 2:180250911-180250933 CTGTGCATGAATGAGCAGGAAGG + Intergenic
946106535 2:217375170-217375192 CCTTGAATAAAGCTGCTGGACGG - Intronic
946450216 2:219773298-219773320 CCTGAAATGAAGGAGCTGGGAGG + Intergenic
946573858 2:221053078-221053100 GCTTGCAGGAGGGAGCTAGAAGG - Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
1169203557 20:3727891-3727913 CCTTCCTTGAAACAGCTGGAGGG - Intergenic
1175348448 20:58300555-58300577 CCTTTCAAGAAGCAGCTGGAGGG - Intergenic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1179363313 21:40733118-40733140 ACATGCATGCAGGTGCTGGAGGG + Intronic
1179482112 21:41685120-41685142 CCTTACAAGAGGGAGATGGAGGG - Intergenic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1180905748 22:19409921-19409943 CCCAGAATCAAGGAGCTGGAAGG - Intronic
1180992280 22:19943882-19943904 TGTGGCATGCAGGAGCTGGAGGG + Intronic
1181411050 22:22719983-22720005 CGGTGCAGGAAGGGGCTGGAAGG + Intergenic
1182421185 22:30249278-30249300 CCTTCCATGAGGGAGCCGGCCGG - Intergenic
1184923682 22:47623229-47623251 CCTTGCATGCATGATATGGAAGG + Intergenic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
952527221 3:34223383-34223405 GCTGGCTAGAAGGAGCTGGAAGG - Intergenic
952608743 3:35181698-35181720 CCATGCTTGAAGGAGCTAAAAGG - Intergenic
953015277 3:39069190-39069212 GCTTGCACTAAGGAGTTGGAGGG - Intronic
953647210 3:44766579-44766601 CCTTGCAATTAGGAGCTGGAGGG + Intronic
954193987 3:48985242-48985264 CCCTGGATGCTGGAGCTGGAGGG + Exonic
954618139 3:51980728-51980750 CCTTGGATGGAAGAGTTGGATGG + Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
956057061 3:65311117-65311139 CCAGGCAGGAAGGAGATGGAAGG - Intergenic
956246867 3:67193125-67193147 CCTTGTAGGAAGAAGCTTGAGGG - Intergenic
957275541 3:78086293-78086315 CCAGGCAGGAAGGAGCAGGATGG - Intergenic
961564124 3:127751279-127751301 CCTTGCTGGGAGGAGCTGCAGGG - Intronic
962189531 3:133295965-133295987 ACTAACATGAAAGAGCTGGACGG + Intronic
964212839 3:154247094-154247116 GTTAGCATGAAAGAGCTGGATGG - Intronic
964417553 3:156463452-156463474 CTTTGCCTGGAGGAGGTGGAGGG - Intronic
965111272 3:164427032-164427054 AAATGCATGAATGAGCTGGAAGG - Intergenic
966019219 3:175187246-175187268 CCTTGCAGGAAGTAGCAGAAAGG + Intronic
967471667 3:189869093-189869115 CCTAGCAATAAGGAGGTGGAAGG - Intronic
967967694 3:194974980-194975002 CCTTGCATGAAGGCGCAGCTGGG - Intergenic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
969640892 4:8397773-8397795 CCTTGGAAGAAGGACCTAGATGG - Intronic
970412047 4:15818143-15818165 CCTGGGATGATGGAGCTGGGTGG + Intronic
972449686 4:39183945-39183967 ACTTGCATGAAGGAGTTCCAGGG + Intronic
973338402 4:48979590-48979612 ACTTGCACCAAGGAGGTGGAGGG - Intergenic
973856297 4:55013684-55013706 TCTGGCCTGAAGAAGCTGGATGG + Intergenic
974121960 4:57649649-57649671 CCATGAATGAAGCAGCAGGAAGG - Intergenic
976079998 4:81345402-81345424 TCTTGGAGGAAGGAGCAGGAGGG + Intergenic
977961576 4:103090989-103091011 CCTTGAGTGGATGAGCTGGAAGG + Intronic
978902695 4:113971824-113971846 CCTTGAATGAAAGAAGTGGATGG + Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
985825154 5:2185916-2185938 CCGTGCTGGAAGGTGCTGGAAGG + Intergenic
989422560 5:41256794-41256816 CCTTTTATCAAGGAGCTGGCTGG - Intronic
991579372 5:68138275-68138297 GCTGGCATGAAGGAGATGGTGGG - Intergenic
991949440 5:71933338-71933360 CTTTGAAGGAAGGAACTGGAGGG - Intergenic
993361366 5:86980814-86980836 ACTTGAATGAAGGAACTGGATGG + Intergenic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
999300719 5:150488563-150488585 CATTGAATGGAGGAGTTGGAAGG + Intronic
1002284904 5:178155651-178155673 CCTTCCATGTAAGAGCTGAAGGG - Intergenic
1006478833 6:34275416-34275438 CCTTGCATGATAGAGCAGGAAGG - Intergenic
1006901099 6:37502071-37502093 CATTGAGTGATGGAGCTGGAAGG + Intergenic
1007218675 6:40261528-40261550 CCTTGCTTCTTGGAGCTGGAAGG + Intergenic
1007829949 6:44630364-44630386 CATAGCATGTAAGAGCTGGAAGG + Intergenic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1010815847 6:80357235-80357257 CCTTGCCTGAAGGAGCAAGGAGG + Intergenic
1013174430 6:107665223-107665245 CCTTGCATTCAGGAGCTCCAAGG - Intergenic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1015688778 6:135896822-135896844 GCTGGAAGGAAGGAGCTGGAAGG - Intronic
1017008695 6:150047162-150047184 ACTTGAATGCAGGAGCTGGCAGG - Intergenic
1017588888 6:155957104-155957126 ACTTGCCTGAAAGAGCAGGAAGG - Intergenic
1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG + Intronic
1018861795 6:167715888-167715910 TCAGGCATGAAGAAGCTGGAAGG + Intergenic
1021467308 7:20959586-20959608 CCTTTCCTGAAAGAGCTAGAGGG + Intergenic
1023868325 7:44249426-44249448 CAGTGCATGAAGGAGCTGGCTGG - Intronic
1024760658 7:52593165-52593187 CCTGGCAAGAGGGAGCAGGATGG + Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1033230889 7:139596674-139596696 CCTTCCAGGAAGGAGCCGGGAGG - Intronic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1037661966 8:20935515-20935537 TCTTGCATTGAGGAGCTTGATGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038332028 8:26616669-26616691 CCTTGCTTCAAGGGGCTGGCGGG + Intronic
1038578411 8:28725378-28725400 CCTGGCTTGATGGAGGTGGATGG + Intronic
1039587477 8:38719327-38719349 CCTTGCCTGAAGCACCTGGGCGG - Intergenic
1047923954 8:129664474-129664496 GTTTTCATGAAGGAGCTTGAAGG - Intergenic
1048369921 8:133768358-133768380 CCTTGCATAGAGGAGGTGGCAGG + Intergenic
1049683210 8:143929014-143929036 CCTTGCAGGAGGGTGCAGGAGGG - Intronic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1053691003 9:40587560-40587582 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054273802 9:63049931-63049953 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054302263 9:63388531-63388553 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054401038 9:64715037-64715059 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054434644 9:65199351-65199373 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054495745 9:65822330-65822352 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1056314446 9:85374453-85374475 CCTTGAATGAAGGAGCGGCTGGG - Intergenic
1057231797 9:93325688-93325710 CCTCGCAGGAAGGAGCTGGGAGG + Intronic
1059082082 9:111260862-111260884 CCTTGCATGTAGGAATTTGAAGG - Intergenic
1059488115 9:114643192-114643214 CATTGCCTGAGGGAGCTGGGAGG - Exonic
1060192874 9:121604072-121604094 CCTTGCAAGAAGGTGATGGTGGG + Intronic
1060403457 9:123361400-123361422 CCTTTCCTGGGGGAGCTGGAAGG + Intronic
1061043031 9:128150652-128150674 CCTTCCATGAAGGCACTGGGTGG - Intronic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061159351 9:128884208-128884230 CCTTGCCTGTAGGAGTTGGAGGG + Intronic
1061582295 9:131545614-131545636 CCATGGAGGCAGGAGCTGGAGGG + Intergenic
1062685973 9:137813677-137813699 CCTCCCGTGAAAGAGCTGGAAGG + Intronic
1190728916 X:53211772-53211794 CCGTGCATGTAGGTGATGGAGGG - Exonic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192784977 X:74326354-74326376 CCTTGCAGGAAGGAGCCACAAGG - Intergenic
1195589609 X:106609624-106609646 TCTTTCATGAATTAGCTGGAAGG + Intergenic
1199664118 X:150082989-150083011 CCTAGCATGGAGTAGCTAGATGG + Intergenic
1201713811 Y:17021097-17021119 CCTTGCATTGTGGAGCTTGAGGG + Intergenic
1202583938 Y:26405712-26405734 CCTGGCATGGAGCAGCTGGGCGG + Intergenic