ID: 1097145473

View in Genome Browser
Species Human (GRCh38)
Location 12:56936646-56936668
Sequence TCTTTGTAGCACTCAGTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097145473_1097145475 3 Left 1097145473 12:56936646-56936668 CCGGTCACTGAGTGCTACAAAGA 0: 1
1: 1
2: 0
3: 9
4: 128
Right 1097145475 12:56936672-56936694 CGCTACAAAGTGCTACAAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097145473 Original CRISPR TCTTTGTAGCACTCAGTGAC CGG (reversed) Intergenic
910673247 1:89794503-89794525 TCTTTACAGGACTCAGTGACTGG - Intronic
913403854 1:118465784-118465806 TCTTTGTAGCAGTGGGTGAACGG + Intergenic
916885495 1:169063836-169063858 TTTTTGTTGCCCTCAGTGAGAGG - Intergenic
917486688 1:175461285-175461307 GATTTATAGCACTCAGTGTCCGG + Intronic
919245997 1:194984830-194984852 TCTTTGTATTGCTCAGTGTCAGG + Intergenic
922706115 1:227791126-227791148 TCTTTGTAGAAAGCAGTGCCTGG - Intergenic
923504591 1:234594572-234594594 TCTTTGTAGCAATGAGAGAACGG - Intergenic
1071498818 10:86189336-86189358 ACTTTGTAGCAGGAAGTGACGGG - Intronic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1079330616 11:19529763-19529785 TCTTCAAATCACTCAGTGACCGG + Intronic
1087255013 11:95943962-95943984 TCTTTATAGCAGTGAGTGAATGG + Intergenic
1088292619 11:108257232-108257254 TCTTGGTAGTACTCTGTCACTGG + Intronic
1088989333 11:114938213-114938235 TCTTTATAGCAATGAGTGAATGG + Intergenic
1089002388 11:115062815-115062837 TCTCTGCAACACTCAGTGTCTGG + Intergenic
1094039964 12:26112239-26112261 TCTTTGGATCACACAGTGCCTGG + Intergenic
1095321664 12:40835903-40835925 TCCTTGTATCCCTCAGTGTCTGG - Intronic
1097145473 12:56936646-56936668 TCTTTGTAGCACTCAGTGACCGG - Intergenic
1097151165 12:56980989-56981011 TCTCTGTGGCCCTCAGTGACCGG - Intergenic
1098689822 12:73472930-73472952 TCTTTGTAGCAGTCTGAGAGGGG - Intergenic
1098975568 12:76898723-76898745 TCTTTCCAGCACTCTGTGCCTGG - Intergenic
1099796921 12:87411051-87411073 TCTTTGTAGCAATGAGAGAATGG + Intergenic
1100427381 12:94499963-94499985 TCATTGTATCACTTAGTGAGTGG + Intergenic
1100918172 12:99451742-99451764 TCTTTGTAACACTATGTGAAAGG - Intronic
1101722485 12:107362173-107362195 TCATTGTAGCATTCAGTATCAGG - Intronic
1106179186 13:27356464-27356486 TGTTTTTAGACCTCAGTGACTGG - Intergenic
1108581175 13:51829713-51829735 TCTTTGTGTCACTCACTGCCTGG - Intergenic
1108777934 13:53788968-53788990 TTTTTATAGCATTCAGTGTCTGG - Intergenic
1112908966 13:104458647-104458669 TCCTTGCAGGACTCAGTCACTGG - Intergenic
1113443041 13:110344554-110344576 TGTTTGTACCACTGAGTAACAGG + Intronic
1115944580 14:38644876-38644898 TCTTTATAGCACTGTGAGACTGG + Intergenic
1116466325 14:45237091-45237113 TATTTGTAGCACTAAGAAACTGG + Intronic
1121635621 14:95452113-95452135 TCTTTGTACCTCTCAATGACTGG - Intronic
1122031085 14:98913091-98913113 AATTTGTAGGACTCAGTGAGAGG - Intergenic
1123178571 14:106445294-106445316 TATTTGTAGTACTCAGTAACTGG - Intergenic
1123212803 14:106776997-106777019 TATTTGTAACACTCAGAAACTGG - Intergenic
1126084091 15:44994767-44994789 TCTTTGTAGCAATCAGGAATGGG - Intergenic
1130266756 15:82412331-82412353 TCTTTCTAGTTCTCAGTGAGAGG + Intergenic
1130303299 15:82696619-82696641 TCTTTGCAGCATTCACTGTCAGG + Intronic
1130614794 15:85394802-85394824 TCCTTCTAGGACTCAGTGAAAGG - Intronic
1131617483 15:94032005-94032027 ACTTTGTAGCACTCTTGGACTGG + Intergenic
1132284047 15:100646715-100646737 TCTTTGTAGTCCTAAGAGACAGG - Intronic
1135895743 16:26400662-26400684 ACTTTGCAGCACTAAGTGAAAGG + Intergenic
1136871318 16:33810471-33810493 TCATTCCATCACTCAGTGACAGG + Intergenic
1142262404 16:89049112-89049134 TCTGTGTAGGACTCACTGACTGG + Intergenic
1203100854 16_KI270728v1_random:1305587-1305609 TCATTCCATCACTCAGTGACAGG - Intergenic
1143367353 17:6416668-6416690 TCTTTCTAGCACTCTCTTACTGG - Intronic
1148563308 17:48618643-48618665 TTTTGGTAGCACTCAGTTCCTGG + Intronic
1150121098 17:62603418-62603440 TTTTTGTATCACTTAGTGACAGG - Intronic
1159703568 18:71659440-71659462 ACTTTCTAGAACTCAGTGTCTGG + Intergenic
1159863381 18:73675466-73675488 TCCCTGTAGCACTAAATGACTGG + Intergenic
925385702 2:3460195-3460217 TCTTTCTAGCCCTCAATTACTGG - Intronic
928828985 2:35455803-35455825 CCTTTTTAGCACCCAGGGACTGG - Intergenic
932280320 2:70485740-70485762 TCTTTGTAGCATACAAAGACAGG - Intronic
938265327 2:129923897-129923919 CCTTTTTGGCACTCAGTCACAGG + Intergenic
938582486 2:132659612-132659634 CCCTTGCAGCAGTCAGTGACAGG + Intronic
939126275 2:138181160-138181182 TCTGTGTGGCACTCAATAACAGG - Intergenic
940492632 2:154383312-154383334 TCATAGTAGCACTCAGTAAAAGG + Intronic
943875380 2:193061107-193061129 TCTTTTTAGCAAACAGTCACTGG - Intergenic
946631632 2:221675538-221675560 TCTTTATATCACTCAATCACTGG + Intergenic
947289228 2:228553539-228553561 TCTTTGTATCACTGTGTGAAAGG - Intergenic
947529469 2:230899568-230899590 CCTTTGGATCACTCAGTGACAGG + Intergenic
947563096 2:231175274-231175296 TCATTGTGGCACACAGTGTCAGG + Intergenic
1171044593 20:21798087-21798109 GCTTTGTAGGACACAGTGAGGGG + Intergenic
1173143031 20:40501359-40501381 TATTTGGAGAACTCAGGGACTGG - Intergenic
1173419740 20:42890581-42890603 TCTTGGTGGCTCTCAGTGGCAGG - Intronic
1175051695 20:56161416-56161438 TATTTCTAGCACTAAGTGTCTGG + Intergenic
1177396066 21:20537957-20537979 TCTCTGAAGCTCTCAGTGAAGGG + Intergenic
1178096856 21:29224226-29224248 TCTTTGTAGCACTGTGAGAACGG + Intronic
1178668839 21:34572675-34572697 TCTTTGTAGCAGTGTGAGACCGG - Intronic
1179123021 21:38566356-38566378 TCGTTGTAGGACTCAGTGTGGGG - Intronic
1179888933 21:44326230-44326252 TCTTTCTTGAGCTCAGTGACGGG - Exonic
1179953746 21:44726646-44726668 GTTTTGTGGCACTCAGGGACAGG + Intergenic
1181424183 22:22822417-22822439 TCTTTCTGGCACTCATTGCCAGG - Intronic
1181691454 22:24564296-24564318 TCTTTGTAGCACAAAGTGGTGGG - Intronic
1182466771 22:30521687-30521709 TGTTTCTAGCACTCACTGCCTGG - Intergenic
1183876743 22:40789278-40789300 TCTCTGTAGGACGCAGGGACCGG - Intronic
950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG + Intronic
953148940 3:40306463-40306485 TCTTTGTTGTGCTCAGTCACTGG + Intergenic
954925257 3:54228392-54228414 TCTGTGTAATTCTCAGTGACAGG - Intronic
955164867 3:56501021-56501043 ACTGAGTAGAACTCAGTGACAGG + Intergenic
956536057 3:70278275-70278297 GCTTTGTAGTACTCCATGACAGG + Intergenic
957198197 3:77098130-77098152 TCTTTGTACCACTCAATGGTGGG - Exonic
957688000 3:83528254-83528276 TCTTTGTAGCACTATGAGAAAGG - Intergenic
957830143 3:85505698-85505720 TCTGTGTACCAGTCAATGACAGG + Intronic
958671441 3:97210700-97210722 TTTATGTAGCACTGAGTAACTGG - Intronic
958893259 3:99803847-99803869 TCTTTGTAGCAGTGAGAGAATGG - Intergenic
960309520 3:116104084-116104106 CCTGTGTAGAACTCAGTGATGGG - Intronic
961662402 3:128476543-128476565 TTTTTGGAGCACACAGTGCCAGG - Intergenic
969559508 4:7938694-7938716 ACTTTGTAGCTCTCAGCGCCTGG - Intronic
969704616 4:8784967-8784989 TCTTTGTAGCCCTCCCTGCCTGG - Intergenic
971509602 4:27407486-27407508 TCTTTATAGCAGTGAGTGAATGG + Intergenic
972853586 4:43079060-43079082 TCCTTGTAACACTGAGTTACAGG - Intergenic
976695140 4:87910915-87910937 TCTTTGTAGCACTCAGCACGTGG + Intergenic
976774370 4:88691295-88691317 TGTCTGTGTCACTCAGTGACAGG + Intronic
976903182 4:90204944-90204966 TCTTTGTAGCAATTGGTGAATGG + Intronic
977042641 4:92033679-92033701 TCTTTGTGGCATTTAGTTACAGG - Intergenic
980084885 4:128380665-128380687 CCCTTGTAGCACTGGGTGACAGG - Intergenic
982546322 4:156737511-156737533 CCTTTATAGCAGTCAGTCACTGG + Intergenic
983758165 4:171368401-171368423 TATTTGTAGCACTTAGAGAAAGG - Intergenic
985133579 4:186763358-186763380 TCTTGGTAGCACCCACTGAGAGG + Intergenic
986096353 5:4557807-4557829 TGCTTTTAGCACTCAGTGCCAGG + Intergenic
987691105 5:21268256-21268278 TCTTTGTAGCACCCAAAGCCTGG + Intergenic
993357107 5:86927948-86927970 TTTTTGTAGAAATTAGTGACGGG + Intergenic
996185503 5:120468970-120468992 CCTTAGAATCACTCAGTGACTGG + Intronic
996990277 5:129622206-129622228 TGTTTGTAGCAAGCAGTTACTGG - Exonic
997799856 5:136849462-136849484 TCTTTGTAGCAACCTGTGAATGG + Intergenic
1000148423 5:158475899-158475921 TCCTTGAAGCACTTTGTGACAGG - Intergenic
1003020235 6:2503143-2503165 TCTTCGGAGCACCCTGTGACTGG - Intergenic
1004873208 6:19928680-19928702 TGTTGGTACCACTCACTGACTGG - Intergenic
1009406261 6:63316959-63316981 TATTTTTAGCAATCAGTTACAGG - Intronic
1013151633 6:107451860-107451882 ACTTTGTAGCCCTCAGGGCCTGG + Intronic
1017166453 6:151412580-151412602 TCTTTATAGCAGTGAGAGACTGG - Intronic
1018559276 6:165084736-165084758 TCTTGGTAGCTCACAGTGAGTGG - Intergenic
1019127069 6:169847685-169847707 TCTTTATAGCACTGAGAGAACGG + Intergenic
1021692541 7:23244555-23244577 TCTATGTAGGACTCAGAGACAGG - Intronic
1022686230 7:32599673-32599695 TCTTTGTAGCAATTTGTGAATGG - Intergenic
1026385464 7:69843067-69843089 CCCTTGTTACACTCAGTGACAGG + Intronic
1031796158 7:126176416-126176438 TCTTTATAGCAATGAGAGACTGG + Intergenic
1034942176 7:155237661-155237683 TGTTTGGAGCCCTCAGTGGCCGG - Intergenic
1035277143 7:157754410-157754432 TCTTTCTAGAACTCAGTGCTTGG - Intronic
1035301063 7:157897413-157897435 TCTCTTTAGCACCCAGTGAAGGG - Intronic
1039480178 8:37867391-37867413 TCTTTGTAGGACACATTGACAGG - Intronic
1042396093 8:68293068-68293090 TCTCTGTAGCTCTCAGCGAGAGG - Intergenic
1043173548 8:76996185-76996207 ACTTGTTAGCACTCAGTAACTGG - Intronic
1044895517 8:96887419-96887441 TCTGTGTAGCACCCAGTGCAGGG + Intronic
1045066913 8:98456373-98456395 TTATTGTAGCACTCAGTAGCTGG - Intronic
1045509098 8:102799744-102799766 TCTTTTTAACACTGAGTGTCTGG + Intergenic
1047300758 8:123611986-123612008 TTTTTGTAGCAATCACTGATAGG + Intergenic
1048636054 8:136296525-136296547 TCTTAGTAGCACTCAGGGCAAGG - Intergenic
1056823417 9:89860349-89860371 TCTGTGTAGCACTCATTTCCTGG + Intergenic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1061039537 9:128131934-128131956 TCTGTGTAGCACTCATTTCCTGG - Intergenic
1185892644 X:3835056-3835078 TCTGTGGGGCACTCAGAGACGGG - Intronic
1185897752 X:3873476-3873498 TCTGTGGGGCACTCAGAGACGGG - Intergenic
1185902871 X:3911907-3911929 TCTGTGGGGCACTCAGAGACGGG - Intergenic
1187563715 X:20427559-20427581 TCACTGTAGCACCCAGTGGCTGG + Intergenic
1189563566 X:42215941-42215963 TCTTTGTTGAAAACAGTGACTGG + Intergenic
1189672657 X:43427365-43427387 ACTATGGAGCACTCAGTGAGAGG + Intergenic
1198434198 X:136599391-136599413 ACTCTGTTGCACACAGTGACTGG + Intergenic