ID: 1097146261

View in Genome Browser
Species Human (GRCh38)
Location 12:56941426-56941448
Sequence ACTACCTTCTGTGCTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097146261_1097146265 0 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146265 12:56941449-56941471 ACAGGCCCTGGAGGACCACCAGG 0: 1
1: 0
2: 3
3: 38
4: 291
1097146261_1097146271 24 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146271 12:56941473-56941495 AGAGCCACATGGCTTTGCAGAGG No data
1097146261_1097146264 -9 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146264 12:56941440-56941462 GAAGGTAGTACAGGCCCTGGAGG 0: 1
1: 0
2: 5
3: 17
4: 184
1097146261_1097146268 13 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146268 12:56941462-56941484 GACCACCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097146261 Original CRISPR ACTACCTTCTGTGCTCATAC TGG (reversed) Intergenic
904782412 1:32960687-32960709 AATAGCTTCTGTGTTCTTACTGG - Intronic
912684096 1:111748523-111748545 TCTACAGTCTGTGCTCAGACAGG + Intronic
914999391 1:152574217-152574239 ACCACATTCTGTCCTCAGACAGG - Intronic
915837254 1:159187831-159187853 ACTACCTTCTGTGCACATGGAGG - Intronic
918125704 1:181581575-181581597 CCTACCTTCTGTCCCCATGCAGG - Intronic
919054676 1:192554692-192554714 ACTTCCTGCTATGCTCATGCAGG - Intergenic
924747062 1:246846017-246846039 ACTTCCTTCTGTCCTCATTGAGG - Intronic
1062859988 10:803501-803523 CCTCCCTTCTGTGCACAGACAGG - Intergenic
1064058286 10:12116367-12116389 ATTGCCTTCTGTGCTCATTTTGG - Intronic
1064981603 10:21172528-21172550 CCTTCCTTCTGTGCCCATCCTGG - Intronic
1068715430 10:60182531-60182553 ATTAACTTCTGTGCTCATAATGG - Intronic
1070952699 10:80443856-80443878 TCTACTTCCTGTGCTCAGACAGG + Intergenic
1075400321 10:122156597-122156619 GCCACCTTCTGTCCTCATCCTGG + Intronic
1076331941 10:129676334-129676356 AGTTCCTTCTGTGAACATACAGG + Intronic
1080828223 11:35866106-35866128 ACAACCTTATGTGATAATACAGG + Intergenic
1085400833 11:76234615-76234637 ACTACCTTCCGCTCTCCTACGGG + Intergenic
1087159604 11:94935878-94935900 ACTGCCTGCTGGGCTCATGCAGG + Intergenic
1093954959 12:25205919-25205941 AGTAACTTCTGTGTTAATACTGG - Intronic
1094797653 12:33994554-33994576 ACTACATTTTGTGCTCCTTCAGG - Intergenic
1095110381 12:38288474-38288496 ACTACATTTTGTGCTCCTTCAGG - Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097134599 12:56841219-56841241 ACTACCTTCTGCGCTGGTAGTGG - Intergenic
1097146261 12:56941426-56941448 ACTACCTTCTGTGCTCATACTGG - Intergenic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097700462 12:62814769-62814791 AGTGCATTCTGTGCTCATACAGG - Intronic
1097887060 12:64739499-64739521 TCTACCTTCTGTTCACATCCAGG - Exonic
1098104978 12:67060116-67060138 ACCACTTTCAGTGCTAATACTGG + Intergenic
1104993076 12:132637354-132637376 ACTCCCCTCTGTGCTCAGAAAGG + Intronic
1107377803 13:39823279-39823301 CCTACCTGCTGTGCTCACATGGG - Intergenic
1107633303 13:42364779-42364801 ACTGCCTTCTGTGCTTGTAGAGG + Intergenic
1108866383 13:54928230-54928252 AGTACCTGCAGTGCTCATTCTGG - Intergenic
1109551938 13:63915471-63915493 AATAACTTCTGTGTTCTTACAGG + Intergenic
1115289257 14:31751886-31751908 CTTGCCTTCTGTGCTCCTACAGG + Intronic
1121507418 14:94487332-94487354 AATACCTTCCGTGCTCTTCCTGG - Exonic
1122281968 14:100628936-100628958 ACTCCCTTCTGTGCCCCTCCTGG + Intergenic
1123135548 14:106024677-106024699 AGTACCTTCTCTGATCATAATGG - Intergenic
1128747546 15:70125157-70125179 TCTACCTTCTGGGCACAGACAGG - Intergenic
1135186427 16:20319877-20319899 CCTACCTTCTGAGCTCATGGAGG + Intronic
1140469875 16:75207975-75207997 GCTACCTGCTGTCCTCACACTGG + Intergenic
1140736138 16:77899402-77899424 CCTACCTTCTGTGATTAGACAGG + Intronic
1142471611 17:166236-166258 ACCAACTTCTGTGCCCAAACAGG + Intronic
1143103955 17:4519290-4519312 ACTGCTTTCTGGGGTCATACAGG + Intronic
1149302169 17:55315520-55315542 ACTAGCTTCTGGGATCATCCTGG - Intronic
1152586265 17:81190802-81190824 ACTGCCTTCTGTGCCCACCCAGG - Exonic
926924991 2:17978253-17978275 ACTAGCTTCTGTGCTTGTATGGG + Intronic
927537250 2:23873209-23873231 ACTTCCTTCTGTGCTATTATTGG - Intronic
928465780 2:31520902-31520924 AGGACTTTCTGTGCTCAAACTGG - Intergenic
932694575 2:73944546-73944568 ACTAGTCTCTGTGCTCAGACAGG - Intronic
938229363 2:129645314-129645336 ATTCCCTTTTGTGCTCATTCTGG + Intergenic
941628215 2:167854046-167854068 AATCCCTACTGTGCTCATCCTGG - Intergenic
946130594 2:217603717-217603739 ACTACCTTCTGATCTCCTGCTGG + Intronic
1172861128 20:38053047-38053069 AAGTCCTTCTGTCCTCATACTGG - Intronic
1173698812 20:45048123-45048145 ACTGCCTTCTATGCTCATGTTGG - Intronic
1174337422 20:49873051-49873073 ACAACCTTCTGTGCTTACACAGG - Intronic
1174755781 20:53157155-53157177 ATTAGCTTCTTTGCTCATAGAGG - Intronic
1179725588 21:43339771-43339793 CCTGCCCTCTGTGCTCACACCGG - Intergenic
1181738138 22:24898138-24898160 ACTGTCTTCTGTGCTCAGACTGG - Exonic
950279662 3:11695872-11695894 ACTTCCTTCTGTGATCATTTCGG - Intronic
951451260 3:22841367-22841389 ACTAGCGTCTGTGCCCATATAGG - Intergenic
951845722 3:27082157-27082179 ACCACCCTCTGTCCTCATCCTGG + Intergenic
955991156 3:64628764-64628786 ACTACCTACTGTGCACTTAATGG - Intronic
956530182 3:70209865-70209887 ACTACCTTCTTTGCACACTCAGG + Intergenic
958723398 3:97874284-97874306 AGTACCTTCTGTGCTGAAATTGG + Exonic
959407577 3:105979238-105979260 ACTACCTCCTGTGTCCAAACTGG + Intergenic
960494419 3:118358055-118358077 ACTACCTGCTGTGCCCTCACTGG - Intergenic
963270138 3:143278237-143278259 ACTACCTTCAGTGCTTACACGGG + Intronic
963741553 3:149086604-149086626 CCTCCCTTCTGTGCTCTGACTGG - Intergenic
965183481 3:165434329-165434351 AGTGGCTTCTGTGCTCATATCGG + Intergenic
965369158 3:167839687-167839709 TCTACCTTTTATGCTTATACTGG - Intergenic
967353318 3:188539373-188539395 AACACCTTCTGTGATCATCCAGG - Intronic
970233070 4:13930744-13930766 AATACCTTCTGTTCACATACAGG + Intergenic
970744798 4:19281713-19281735 ACTACCTTCTGTGCACCCACAGG + Intergenic
972979166 4:44675044-44675066 AGTACCTTCTGCGTTCTTACAGG - Intronic
976332106 4:83844495-83844517 ATTTCCTTCTGTTCTCATTCAGG - Intergenic
982349943 4:154404366-154404388 ACTATGTTCTGTGATCATAATGG - Intronic
989227175 5:39042601-39042623 TGTACCTTCAGTGTTCATACCGG + Intronic
989582874 5:43049811-43049833 ACTACCTTATTGGCCCATACTGG + Intergenic
992564692 5:77985849-77985871 ACTACCTTCTGGGCTGTTCCCGG + Intergenic
995486238 5:112642969-112642991 ACTACCTGCTGTGCAGACACAGG - Intergenic
996488553 5:124065567-124065589 ACTACCATCTGTGGACTTACAGG - Intergenic
996715813 5:126587205-126587227 GCTACATTCTGTGCTGAAACTGG + Intronic
1002910868 6:1489974-1489996 ACTTCCTTCAGTGCCCAAACAGG - Intergenic
1008454560 6:51694237-51694259 ACTACATTCTGGTCTCATCCTGG + Intronic
1008754248 6:54775027-54775049 AATAACTTCTGTGTTAATACTGG + Intergenic
1009559924 6:65226396-65226418 AATACATCCTGTGCTCATAATGG + Intronic
1012266268 6:97147497-97147519 ACTACCTTGTGTGGTTATGCAGG - Intronic
1013785690 6:113777665-113777687 ACGAACTTCTATGCTGATACTGG + Intergenic
1015325878 6:131922844-131922866 TTTACATTCTGTGCTCATATGGG + Intergenic
1015907545 6:138132552-138132574 ACTATCTTCTCTGATCATAATGG - Intergenic
1018540920 6:164878242-164878264 ACTACCATCTGTGGACTTACAGG + Intergenic
1021932669 7:25597266-25597288 ACAACCTTCTGTGAACATATGGG + Intergenic
1024024285 7:45398246-45398268 CCTACCTTCTGTACACATAGTGG + Intergenic
1026244755 7:68609875-68609897 GCTTCCTTCTGTGCTAAGACTGG - Intergenic
1032021487 7:128409329-128409351 ACTATCTTCAGTGGTCTTACTGG - Exonic
1039163980 8:34655502-34655524 ACAATCTTCAGGGCTCATACAGG + Intergenic
1044763134 8:95543546-95543568 TCTACCTTCTTTCCTCATTCTGG - Intergenic
1057722712 9:97545849-97545871 AGTGCCCTCTGTGCTCAGACTGG + Intronic
1187170772 X:16849366-16849388 ATTACTTTCTGGGCTGATACTGG - Intronic
1195743688 X:108092024-108092046 ACTACCTACTGAGCTCGAACCGG + Intronic