ID: 1097146261

View in Genome Browser
Species Human (GRCh38)
Location 12:56941426-56941448
Sequence ACTACCTTCTGTGCTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097146261_1097146265 0 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146265 12:56941449-56941471 ACAGGCCCTGGAGGACCACCAGG 0: 1
1: 0
2: 3
3: 38
4: 291
1097146261_1097146268 13 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146268 12:56941462-56941484 GACCACCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 16
4: 176
1097146261_1097146271 24 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146271 12:56941473-56941495 AGAGCCACATGGCTTTGCAGAGG No data
1097146261_1097146264 -9 Left 1097146261 12:56941426-56941448 CCAGTATGAGCACAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1097146264 12:56941440-56941462 GAAGGTAGTACAGGCCCTGGAGG 0: 1
1: 0
2: 5
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097146261 Original CRISPR ACTACCTTCTGTGCTCATAC TGG (reversed) Intergenic