ID: 1097146838

View in Genome Browser
Species Human (GRCh38)
Location 12:56947254-56947276
Sequence TCTAGAAAACAGACTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1581
Summary {0: 1, 1: 3, 2: 83, 3: 436, 4: 1058}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097146838 Original CRISPR TCTAGAAAACAGACTTAAAA GGG (reversed) Intergenic
901848968 1:12003215-12003237 TCAAGAAAACTGACTAAAACTGG - Intronic
902268619 1:15287247-15287269 TCCTGAAAACAGACTTCAAGTGG + Intronic
904292205 1:29494814-29494836 TCTACAAAACTAACTCAAAATGG - Intergenic
905598322 1:39228307-39228329 TCTCAAAAACAGACAAAAAAAGG + Intronic
905847696 1:41246486-41246508 TCTGGAAATCAGACTTTATAAGG + Intergenic
906063704 1:42964793-42964815 TTTAGAAAACAGAGAGAAAAAGG - Intergenic
906438390 1:45817084-45817106 TCTAGAAAATAGCCTCCAAAAGG + Intronic
906983073 1:50652459-50652481 TGTAGAAACCAGACTGAAATTGG - Intronic
907066352 1:51487361-51487383 TTTTGAAAACAGACTTTAAATGG + Intronic
907102747 1:51851608-51851630 TCCAGAAAAAAGCCTGAAAAGGG + Intronic
907234331 1:53031297-53031319 TATAGAGAAAAGAATTAAAATGG - Intronic
907582107 1:55581802-55581824 TCTACAAAACAGAAATAATAAGG + Intergenic
907695790 1:56727334-56727356 TCTAGAAGATATACTTAGAAGGG - Intronic
908024631 1:59937707-59937729 TCTAGAAAATAGCATCAAAAGGG - Intergenic
908069525 1:60442898-60442920 TTTGGAAAAGAGATTTAAAAAGG - Intergenic
908093204 1:60708192-60708214 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
908145292 1:61235024-61235046 TTAAGAAAAAAGTCTTAAAAGGG - Intronic
908175396 1:61551014-61551036 TCTAGAAAATAGCTTCAAAAAGG - Intergenic
908678408 1:66631913-66631935 TCTTAAAAACTGAATTAAAATGG + Intronic
908810085 1:67972871-67972893 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
908958756 1:69669705-69669727 TCTAGAAAATAGCCTCAAACGGG - Intronic
909332330 1:74428527-74428549 TCTAAAAAACAGACTTCCATAGG + Intronic
909384951 1:75043861-75043883 TCTAGAAAACATCCTCAAAAAGG + Intergenic
909438842 1:75674721-75674743 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
909582634 1:77254961-77254983 TATAGAAAACAGCATCAAAAGGG + Intergenic
910290012 1:85590535-85590557 TCTAGAAAATAGCATCAAAAGGG + Intergenic
910314147 1:85863034-85863056 TCTAGAAATCCAACTTACAAGGG - Intronic
910547522 1:88434514-88434536 TCTAGAAAATAGCCTCGAAAAGG + Intergenic
910589563 1:88915334-88915356 ACTAGAAAACAGAGAAAAAATGG - Intergenic
910620700 1:89250146-89250168 TCTAGAAAATTACCTTAAAAGGG + Intergenic
910627303 1:89321662-89321684 TCTAGAAAACAGCCTCAAAAAGG - Intergenic
910801194 1:91148353-91148375 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
910819042 1:91326114-91326136 TCTGGAAAATAGCCTCAAAAGGG + Intronic
910995434 1:93099684-93099706 TCTAGAAAGCAGAGTGATAAGGG + Intronic
911182045 1:94869836-94869858 TCTGGAAATCAGATTTAAAAAGG + Intronic
911187076 1:94915046-94915068 TCTACAAAACATTTTTAAAAAGG - Intronic
911291533 1:96062184-96062206 TCCAGAAATCATAATTAAAATGG + Intergenic
911343772 1:96672655-96672677 TCTAGAAAATAGCCTCAGAAAGG - Intergenic
911373835 1:97025966-97025988 TCTAGAAAATAGCATCAAAAGGG + Intergenic
911378181 1:97077246-97077268 TCTAGAAAAGAGATTTACCAGGG - Intergenic
911496665 1:98639213-98639235 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
911518113 1:98893864-98893886 TATACAAAACACATTTAAAATGG - Intronic
911705828 1:101011649-101011671 TCTATAAAACAGATTTATATGGG + Intronic
912015501 1:105028850-105028872 TCTAGAAAATAGCATCAAAAGGG + Intergenic
912036447 1:105323131-105323153 TATAGAAAATAGCCTCAAAAAGG - Intergenic
912059152 1:105642724-105642746 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
912152928 1:106881513-106881535 TCTAGAAAATGGCCTCAAAAGGG + Intergenic
912316589 1:108672343-108672365 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
912601290 1:110935697-110935719 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
912606986 1:111001536-111001558 TCTACAAAATAGCCTCAAAAGGG - Intergenic
912785752 1:112602312-112602334 TCAAGTAAACACATTTAAAAAGG - Intronic
912871749 1:113312957-113312979 TCTAGAAAACAGCCTCAAAAAGG + Intergenic
912899092 1:113629057-113629079 TCTAGAAAACAGCCTCAAAAGGG - Intronic
913032383 1:114922272-114922294 TCTAGAAAACAGCCTCAAAAGGG - Intronic
913059740 1:115194059-115194081 TCTAGAAAACATAGCTCAAAGGG - Intergenic
913707080 1:121435854-121435876 TCTAGAAAATATCCTCAAAAGGG + Intergenic
915005535 1:152631665-152631687 TCTACAAAACAGCCTCAAAAGGG + Intergenic
915659824 1:157394055-157394077 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
915746173 1:158159731-158159753 TTTAAAACACAGACTTAATAGGG + Intergenic
915753062 1:158229907-158229929 TCTAGAAAATAGCCCTCAAAAGG + Intergenic
915857009 1:159398763-159398785 TCTAGAAAATAGTCTCAAAAAGG + Intergenic
916321983 1:163514345-163514367 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
916341664 1:163743904-163743926 TCTAGAAAACAGCCTTAAAGGGG - Intergenic
916369301 1:164072552-164072574 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
916616232 1:166443826-166443848 TTTAGAAAATAGCCTCAAAAGGG - Intergenic
916860795 1:168802920-168802942 TGTAGAAGACAGTCTGAAAAGGG - Intergenic
916968787 1:169985383-169985405 TTTAGAAAACAGAACCAAAATGG + Intronic
917003177 1:170384085-170384107 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
917015873 1:170531167-170531189 TCTGAAAAACAGATTTAAAGGGG + Intergenic
917306443 1:173629658-173629680 TCTAGAAAATAGCCTCAAAAGGG + Intronic
917376389 1:174352204-174352226 TCTAGAAAATAGCTTCAAAAGGG - Intronic
917404880 1:174695247-174695269 TCTAGAAAATAGCCTCAAAAGGG - Intronic
917986447 1:180325237-180325259 TCTAGAAAACAGCCTCAAAAGGG - Intronic
918370289 1:183854159-183854181 TCTATAACACAGAGTTATAAAGG + Intronic
918415920 1:184308786-184308808 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
918476070 1:184926802-184926824 TCTAGAAAATAGCCTCAAAAGGG - Intronic
918539528 1:185614641-185614663 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
918756306 1:188342918-188342940 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
918971549 1:191426383-191426405 TCTATAAAACATGCTTAAAACGG - Intergenic
918989775 1:191683797-191683819 TACAGAAAACAGCCTCAAAAGGG - Intergenic
919003287 1:191861809-191861831 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
919090121 1:192968627-192968649 TCCAGGAAACTGCCTTAAAAGGG + Intergenic
919200599 1:194350228-194350250 TCTAGAAAACAGGATAAAATTGG + Intergenic
919224195 1:194673537-194673559 TCTCAAAAAAAGACATAAAATGG - Intergenic
919283878 1:195527557-195527579 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
919287756 1:195586094-195586116 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
919336820 1:196245847-196245869 TCTAGAAAACAGCACCAAAAGGG + Intronic
919511690 1:198473158-198473180 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
919608544 1:199716571-199716593 TCTAACAGACAGTCTTAAAATGG + Intergenic
919694998 1:200565689-200565711 TCCTGAAAACAAGCTTAAAATGG - Intronic
920395493 1:205642648-205642670 ATTAGAAATAAGACTTAAAATGG - Intergenic
920594762 1:207258154-207258176 TCTAGAAAATAGCTTCAAAAGGG - Intergenic
920953482 1:210596467-210596489 TCTAGAAAACAGCCTCGAAAAGG - Intronic
921147134 1:212368706-212368728 TCTAGAAAATAGCCTCAAAAGGG + Intronic
921295935 1:213703968-213703990 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
921488915 1:215750051-215750073 TCCTAAAAAAAGACTTAAAAAGG - Intronic
921757742 1:218879715-218879737 TCAAAAAGACAGACTCAAAAGGG + Intergenic
921823350 1:219642249-219642271 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
922014329 1:221629279-221629301 TCTGGAAAACAGCCTCAAAAAGG - Intergenic
922044476 1:221930041-221930063 TCTAGAAAATAGTCTCAGAAAGG + Intergenic
922201237 1:223403267-223403289 ACAAGAAAACAGGCTCAAAAAGG - Intergenic
922319947 1:224478303-224478325 TCTAGAAAATAACCTCAAAAGGG - Intronic
922377715 1:224985902-224985924 TCTAGAAAATAGCCTCAAAAGGG + Intronic
923100482 1:230810607-230810629 TGTTGAAAACATACTGAAAATGG - Intergenic
923647916 1:235843032-235843054 TCTAGAACACAGACATGACAAGG - Intronic
923886455 1:238163239-238163261 TCTATAAAAGAGCCTCAAAAGGG - Intergenic
923960212 1:239072894-239072916 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
923968536 1:239172635-239172657 TCTTTAAAGCAGGCTTAAAATGG + Intergenic
924490641 1:244534405-244534427 TCTAGAAAACAGCCTCAACGGGG - Intronic
924660441 1:246011495-246011517 TTTAGAAAAAGGACATAAAAAGG + Intronic
924792688 1:247267878-247267900 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1063236270 10:4119762-4119784 TCTAGAAAACTGAAGTAGAATGG + Intergenic
1063588559 10:7374685-7374707 TCTAAAGAAAACACTTAAAAAGG + Intronic
1064446693 10:15400064-15400086 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1064704385 10:18056568-18056590 GACAGAAAACAGACTCAAAAAGG - Intergenic
1064909367 10:20383727-20383749 TATAGAATTCAGAATTAAAAGGG + Intergenic
1065381349 10:25094669-25094691 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1065426765 10:25614281-25614303 TCTAGAAAATAGCCTCCAAAGGG - Intergenic
1065431292 10:25659954-25659976 TCTAGAAAATAGCCTAAAAGGGG - Intergenic
1065480829 10:26192514-26192536 GCCAGAAAAAAAACTTAAAAAGG - Intronic
1065611492 10:27475536-27475558 TATAAAAAACAGATTTGAAAGGG + Intergenic
1065922010 10:30401156-30401178 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1066142811 10:32525012-32525034 TCTAGAAAACAGCCTCATGAGGG - Intronic
1066514324 10:36139966-36139988 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1066527133 10:36293812-36293834 TCTGAAAAACAGCCTCAAAAGGG - Intergenic
1067700241 10:48566435-48566457 TCCAGAATACAGATTTAAAAAGG + Intronic
1068217447 10:54000687-54000709 TCTAGAAAATGGCCTCAAAAGGG + Intronic
1068256624 10:54519485-54519507 CCTAGAAATCTGACTTACAAGGG + Intronic
1068447995 10:57147477-57147499 TCTAGAATATAGCCTTAAAATGG + Intergenic
1068840262 10:61605301-61605323 TCTAGAAAATAGCCTCAAAATGG - Intergenic
1069019434 10:63468996-63469018 TTTAAAAAACTGACTTATAAAGG + Intergenic
1069063970 10:63923288-63923310 TCAAGAAAACAGCCTCAACAAGG - Intergenic
1069193298 10:65518142-65518164 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1069343660 10:67441309-67441331 TCTAGAAAATAGCCTCGAAAGGG + Intronic
1069388561 10:67908298-67908320 TATAGAAAACAGCCCTATAAAGG + Intronic
1069395136 10:67979455-67979477 TCTAGAAAAAAGGCCCAAAAGGG + Intronic
1069397623 10:68007116-68007138 TCTAGAAAATAGCTTCAAAAGGG - Intronic
1070036728 10:72732909-72732931 TGTAGAAAAAACACTCAAAAGGG - Intronic
1070478351 10:76852702-76852724 TCTACAAAATAGCCTCAAAAGGG + Intergenic
1071018231 10:81022747-81022769 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
1071050961 10:81448700-81448722 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1071109222 10:82135481-82135503 TCTAGAAAATAGTCTCAAAGGGG - Intronic
1072282678 10:93882706-93882728 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1072978320 10:100078494-100078516 TCTGGATAATAGACTTTAAAGGG - Intronic
1073161577 10:101402122-101402144 ACTAGCATACAGCCTTAAAAAGG - Intronic
1073373618 10:103013256-103013278 ATCACAAAACAGACTTAAAAAGG - Intronic
1073435292 10:103512629-103512651 TCTACCAAACAAACATAAAAAGG + Intronic
1073654410 10:105397280-105397302 TTTAGAAAACACACTACAAATGG - Intergenic
1073872582 10:107881801-107881823 TCTAGAGAATAGCCTCAAAAGGG + Intergenic
1074301970 10:112241097-112241119 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1074638848 10:115354830-115354852 TCTAAAAAAGAGCCTCAAAAGGG - Intronic
1074664775 10:115708508-115708530 TCTAACAAACAGTATTAAAAAGG - Intronic
1074804193 10:117030858-117030880 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1074957254 10:118404324-118404346 TCTAGACAGCAGAAATAAAAGGG - Intergenic
1075213159 10:120508875-120508897 TCTAGAAAAGACTGTTAAAAGGG - Intronic
1075830418 10:125406256-125406278 TCTAGAAAATAGCCTCATAAGGG - Intergenic
1076094793 10:127722373-127722395 TCTAGAAAGTAGCCTCAAAATGG + Intergenic
1076227313 10:128789821-128789843 TCTAGAAAACAACATGAAAAGGG + Intergenic
1077427640 11:2491571-2491593 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1077551557 11:3202766-3202788 TGTAAGAAACAGACTTGAAAGGG - Intergenic
1077709826 11:4524653-4524675 TCTAAAAAATAGCCTCAAAATGG + Intergenic
1078244477 11:9561729-9561751 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1078992850 11:16666860-16666882 TCTAGAAAATAGTCTTAAAAGGG + Intronic
1079038111 11:17038265-17038287 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1079068608 11:17321879-17321901 TCTCGAAAGAAGACATAAAATGG - Intronic
1079069087 11:17327566-17327588 TCTAGAAAACAGCCTCAAAACGG - Intronic
1079183707 11:18216791-18216813 TCTAGAAAACAGTCTCAGAAAGG + Intronic
1079530399 11:21445987-21446009 TCTAGAAAATAGTCTCAAAAGGG - Intronic
1079701556 11:23554907-23554929 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1079713060 11:23709984-23710006 ACTAGAAAATAGCCTCAAAAGGG + Intergenic
1079922570 11:26451077-26451099 ATTAGAAAACAGACTTATAGGGG + Intronic
1080128750 11:28768074-28768096 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
1080134824 11:28842398-28842420 TCTAGAAGACTTGCTTAAAAAGG - Intergenic
1080146962 11:28997704-28997726 ACTAGAAAACAGGCTGAAAGAGG - Intergenic
1080213522 11:29815782-29815804 TCTAGAAAATAGCTTCAAAAGGG - Intergenic
1080217879 11:29866524-29866546 CCTAGAAATCAGACTCACAATGG + Intergenic
1080489609 11:32749183-32749205 TCGAGAAAATAGCCTCAAAAGGG - Intronic
1080707048 11:34706121-34706143 TCTAGAAAATTGACTCAAAAGGG - Intergenic
1080965973 11:37215794-37215816 TCTAGAACACAGCCTCACAAAGG - Intergenic
1081049337 11:38317381-38317403 TCTGGAAAACAGGCTCAAAAGGG + Intergenic
1081112217 11:39150212-39150234 TCCAGAAAATAGCCTCAAAAGGG + Intergenic
1081426621 11:42932817-42932839 TCTAGAAAACAAAATTAGACAGG + Intergenic
1082114580 11:48314473-48314495 TCTAGAAAATAGCCTGAAAAGGG - Intergenic
1082252060 11:49993473-49993495 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1082721339 11:56680720-56680742 TCTAGAAAATAACCTCAAAAGGG + Intergenic
1082949264 11:58793074-58793096 TCTGAAAAACAAATTTAAAAAGG + Intergenic
1082953945 11:58848704-58848726 TATAGAAAATAGCCTTGAAAGGG + Intronic
1082968495 11:58993587-58993609 TCTAGAAAAGAGAAGTAAAATGG - Intronic
1082970363 11:59013956-59013978 TATAGAAAATAGCCTTGAAAGGG + Intronic
1083102561 11:60324606-60324628 TCAGGAAAACAGATTTAAAAAGG + Intergenic
1083605682 11:63977292-63977314 TCTTGAAAAAAAAATTAAAAAGG - Intronic
1083717536 11:64586450-64586472 TGTGGAGAACAGACTGAAAATGG - Intergenic
1084655376 11:70512623-70512645 TCAGGAAGACAAACTTAAAATGG - Intronic
1085194501 11:74660447-74660469 TCTAGACAACAGGCTCAAAAGGG - Intronic
1085571944 11:77567634-77567656 TCTAGAAAATAGCCTCAAAGGGG - Intronic
1085778379 11:79386577-79386599 TCTGGAAAAAAGACTTGAACAGG + Intronic
1085981496 11:81731775-81731797 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1086033264 11:82385236-82385258 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1086068926 11:82777362-82777384 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
1086239507 11:84672630-84672652 TCTAGAAAAGCGCCTTAAAATGG + Intronic
1086277185 11:85145466-85145488 TCTAGAAAACAGTCTCAAAAGGG - Intronic
1086524494 11:87709734-87709756 TCTAGAAAATAGCCTCAAAATGG - Intergenic
1086569792 11:88268328-88268350 TCTAGAAAGTAGACTGAAAAGGG + Intergenic
1086899011 11:92345257-92345279 TCTAACAAACAGCCTTGAAATGG - Intergenic
1086962082 11:92988326-92988348 TATAGAAAACCAACTCAAAATGG - Intergenic
1087005790 11:93469752-93469774 TAAAGAAAAAAGACTTAAATTGG - Intergenic
1087031791 11:93713801-93713823 TCTAGAAAATAGCTTTAAAAGGG - Intronic
1087178471 11:95118800-95118822 TCTAGAAAATAGCCTCAAAGGGG - Intronic
1087219425 11:95530315-95530337 TCTAGGAAACAGACTCAAGTGGG + Intergenic
1087221401 11:95550408-95550430 TCTAGAAAGTAGACTTCAACAGG + Intergenic
1087313206 11:96575748-96575770 TCCATAAAACAGCCTCAAAATGG - Intergenic
1087417049 11:97870780-97870802 CCTAGAAAATAGCCTCAAAAAGG - Intergenic
1087492226 11:98843444-98843466 TCTAGAAAATAGCCTCAAAATGG - Intergenic
1087532712 11:99405346-99405368 TCTAGAAAATAACCTCAAAAAGG - Intronic
1087553421 11:99682202-99682224 TCTTGAAATATGACTTAAAAGGG + Intronic
1087598216 11:100281728-100281750 TTTAGAAAATAGCCTCAAAAGGG - Intronic
1087659765 11:100973517-100973539 TCTACATAATAGACTTCAAAAGG + Intronic
1087824418 11:102748731-102748753 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1087877114 11:103371302-103371324 TCTAGAAAGTAGACTGAAAAGGG + Intronic
1087887727 11:103499176-103499198 TATAGAAAATAGCCTCAAAAGGG + Intergenic
1087950649 11:104217389-104217411 TCTAGAAAACAGACTCAAAGGGG - Intergenic
1088046563 11:105458743-105458765 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
1088111731 11:106268833-106268855 TCTAGAAAATAGCCTGAAAAGGG - Intergenic
1088182004 11:107122891-107122913 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
1088330811 11:108649016-108649038 TCTAGAACATAGCCTCAAAAAGG + Intergenic
1088411350 11:109538229-109538251 TCTAGAATATAGCCTCAAAAGGG - Intergenic
1088436943 11:109824393-109824415 TATAGAAAACAGAATTAGAGAGG - Intergenic
1088450391 11:109975564-109975586 TTTGGAAATCAGAATTAAAATGG + Intergenic
1088570111 11:111214572-111214594 TATAGAAAATAGCCTCAAAAGGG + Intergenic
1088735076 11:112721996-112722018 TCTAGAATATAGCCTTCAAAAGG - Intergenic
1089142189 11:116294415-116294437 TCTAGAAATCAGAGTGGAAATGG + Intergenic
1089507435 11:118972962-118972984 TGGAGAAAACAGACGTTAAATGG - Intronic
1089824535 11:121263363-121263385 TCTATAAAATAGCCTTAAAATGG - Intergenic
1090065088 11:123496590-123496612 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1090318132 11:125815853-125815875 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1090885438 11:130872205-130872227 CCAAGAAAGCAGAGTTAAAATGG + Intergenic
1091037235 11:132245197-132245219 ACAAGAAAACAGACTTCACACGG - Intronic
1091336256 11:134768795-134768817 CCTAGAAAACAGCCTCAGAAAGG + Intergenic
1091519874 12:1227451-1227473 TCTCGAAAGAAGACTTTAAATGG - Intronic
1092320352 12:7466153-7466175 TCTAGAAAATACCCTCAAAAGGG + Intronic
1092662220 12:10750757-10750779 TCCAGAAAATAGACTAGAAAGGG - Intergenic
1093321162 12:17717246-17717268 TCTAGAAAATGACCTTAAAAGGG - Intergenic
1093403767 12:18779583-18779605 CCTAGAAAATAGCCTCAAAAGGG - Intergenic
1093403953 12:18781696-18781718 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
1093988665 12:25566235-25566257 ACTAGAAAATAGACTTGAAAGGG - Intronic
1094086798 12:26602211-26602233 TGTAGAAAACATACACAAAAGGG + Intronic
1094380588 12:29839267-29839289 TCTAGAAAATAGCTTTAAATGGG - Intergenic
1094559408 12:31536571-31536593 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1094658011 12:32439813-32439835 TCTAGAAACTAGCCTCAAAAGGG - Intronic
1095181540 12:39152669-39152691 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1095227757 12:39696926-39696948 TCTAGAAAATAGCCTCAAGAGGG + Intronic
1095807973 12:46342114-46342136 TCTAGAAACTAGCCTCAAAAGGG - Intergenic
1095862017 12:46927800-46927822 TTTAAGAAACAGACTTAAATTGG + Intergenic
1096451148 12:51742841-51742863 TCTAGCAAATAGCCTCAAAAGGG - Intronic
1096543936 12:52324080-52324102 CCTTGAAAACAGACTTAGACAGG + Intergenic
1096661718 12:53129381-53129403 TCTACAACACAGGCTTCAAATGG + Intergenic
1096809902 12:54162601-54162623 TCAAGCAAAGAGACTTCAAATGG + Intergenic
1096984127 12:55745160-55745182 TCTAGGAAACAGAGTTATAGAGG + Intronic
1097059829 12:56274449-56274471 TCTAAAAAACAGTTTTAAATAGG - Intronic
1097146838 12:56947254-56947276 TCTAGAAAACAGACTTAAAAGGG - Intergenic
1097150596 12:56976587-56976609 TCTAGAAAATAAACTTAGAAGGG - Intergenic
1097370642 12:58775646-58775668 TCTAGAAAATAGAGGTATAATGG - Intronic
1097500039 12:60390595-60390617 TCCAGAAAACAGAGGTAAACAGG - Intergenic
1097508785 12:60509038-60509060 TCTAGAAAATAGACTCAAAATGG + Intergenic
1097791413 12:63819163-63819185 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1097899040 12:64855469-64855491 TCTAGCAAATAGCCTCAAAAGGG - Intronic
1098043838 12:66379903-66379925 TCAAGAAAAAAGATTTGAAATGG - Intronic
1098395475 12:70012348-70012370 TCTAGAAAAAAGCCTCAAATGGG + Intergenic
1098491855 12:71091662-71091684 TCTAGAAAATAGCCTCAAAGGGG - Intronic
1098975478 12:76897555-76897577 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1099024666 12:77449715-77449737 TCTAGAAAACAGCTTCAAAAAGG + Intergenic
1099100785 12:78438306-78438328 TCTAGAAAATAGTCTCAAGAGGG - Intergenic
1099110830 12:78558711-78558733 TATAGAAAACAGACATTGAAAGG - Intergenic
1099562073 12:84191486-84191508 GCTAGAAAATAGCCTCAAAAGGG - Intergenic
1099564720 12:84229029-84229051 TCTAGAAAGTAGCCTCAAAAGGG - Intergenic
1099808334 12:87548013-87548035 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1099947186 12:89258123-89258145 TCTAGAAAATAGGCTTAGATGGG - Intergenic
1099992398 12:89738059-89738081 TCTAGAAAAAAGCCTCAAAAGGG + Intergenic
1100144732 12:91663872-91663894 TATAGAGAACAGACCTCAAAGGG + Intergenic
1100946543 12:99789861-99789883 TCTAGACAACAGTCTCAAGAGGG + Intronic
1101025986 12:100607566-100607588 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1101171900 12:102106135-102106157 TCTAGAAAACAGGCATGGAATGG + Intronic
1102318126 12:111906453-111906475 TCTAGCAAATAGTCTCAAAAGGG + Intergenic
1104243113 12:127010656-127010678 ATGAGAAAACAGGCTTAAAATGG - Intergenic
1104591833 12:130090193-130090215 TCAGGAAAACAGGCTTTAAAAGG - Intergenic
1105558852 13:21471902-21471924 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
1106074953 13:26450080-26450102 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1106638035 13:31552244-31552266 TTAAGAAAACACTCTTAAAAGGG - Intergenic
1106827202 13:33536648-33536670 TCTGAAAAGCAGAATTAAAAGGG + Intergenic
1106963903 13:35037042-35037064 TCTAGAGAATAGCCTCAAAAGGG - Intronic
1107178273 13:37424622-37424644 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1107193049 13:37613049-37613071 TCTAGAGAAAATACTAAAAAGGG - Intergenic
1107196902 13:37663271-37663293 TGCAGAAAACAGAATTAACATGG - Intronic
1107205521 13:37781193-37781215 TCTAGAAAATAGAACTAAGAAGG + Intronic
1107228343 13:38077735-38077757 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1107265840 13:38553304-38553326 TCTAGAAAATAGCCTCAAAATGG - Intergenic
1107287639 13:38813840-38813862 TCTAGAAAAGACCCTCAAAAGGG - Intronic
1107523993 13:41212407-41212429 TCCAGAAAATAGCCTGAAAATGG - Intergenic
1107582351 13:41804041-41804063 TCTAGAAAATGGCCTAAAAAGGG + Intronic
1107774237 13:43821624-43821646 TCTACAAAATAGCCTCAAAAGGG - Intergenic
1107808058 13:44173368-44173390 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1107952852 13:45480103-45480125 TCTAGAAAACAGAACCAAAAGGG - Exonic
1107986082 13:45777428-45777450 CCTAAAAAAAAGACTGAAAAAGG + Exonic
1108109179 13:47049308-47049330 AGTACGAAACAGACTTAAAAAGG - Intergenic
1108332588 13:49404928-49404950 TCTAGAAAATAGCCTCAAAATGG + Intronic
1108365027 13:49702615-49702637 TCTAAAAAACAGACAAAACACGG + Intronic
1108562787 13:51662857-51662879 TCTACTAAATAGAGTTAAAAAGG + Intronic
1108631519 13:52288271-52288293 TCTAGAAAATAGCATCAAAAGGG - Intergenic
1108655173 13:52524324-52524346 TCTAGAAAATAGCATCAAAAGGG + Intergenic
1108667150 13:52644043-52644065 GCTACAAAACAGACCTAGAATGG - Intergenic
1108828635 13:54449589-54449611 TCTCCAAAACAGATTTAAAATGG + Intergenic
1108878969 13:55085845-55085867 TCTAGAAAACAGCTTCAAGAGGG - Intergenic
1108890084 13:55246050-55246072 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
1108898586 13:55367064-55367086 TATAGGAAACAGCCTTTAAAAGG + Intergenic
1109161440 13:58980159-58980181 TCTAGAACACAGAATAAAACAGG + Intergenic
1109211089 13:59536909-59536931 TCTAGAAAATAGACTTGAAAGGG - Intergenic
1109252885 13:60041406-60041428 TCTAGAGGACAGACTGGAAATGG + Intronic
1109336532 13:61002157-61002179 TCTAGAAAATAGCCTCACAAGGG - Intergenic
1109522586 13:63532687-63532709 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1109547947 13:63852574-63852596 TTTAGAAAAAAAATTTAAAAAGG - Intergenic
1109554483 13:63954302-63954324 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1109606414 13:64703866-64703888 TCTTGAAAACATATTTAATAAGG + Intergenic
1109686037 13:65820691-65820713 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1109747821 13:66649061-66649083 TCTAGAAAATGGCCTAAAAAGGG + Intronic
1109923884 13:69107765-69107787 TCAAGAAAACAGCCTCAGAAGGG + Intergenic
1109990826 13:70054926-70054948 ACTAGAAAACAACCTCAAAAGGG + Intronic
1110135236 13:72059963-72059985 TCTAGAATATAGCCTGAAAAGGG + Intergenic
1110170514 13:72495169-72495191 TTTAAAAAAAAAACTTAAAAAGG + Intergenic
1110210577 13:72967767-72967789 TTTAAAAAACAGATTTTAAAAGG + Intronic
1110308884 13:74023302-74023324 GCTAAAAAACAGACTTACAGGGG + Intronic
1110576343 13:77059653-77059675 TCTAGAAAACATCCATAAGAAGG - Intronic
1110665631 13:78114767-78114789 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1110889321 13:80678828-80678850 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1110913731 13:80996194-80996216 TCTAGAAAATAGCCTCCAAAGGG - Intergenic
1110915030 13:81010800-81010822 TGTAGAAAATAGCCTCAAAAAGG - Intergenic
1110916584 13:81029190-81029212 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
1110965892 13:81696716-81696738 TCTAATAATCAGACTAAAAATGG + Intergenic
1110974338 13:81809755-81809777 TCTAGGAAACAGCTTCAAAAGGG + Intergenic
1111130492 13:83968972-83968994 TCTAGAAAATAGCCTCAAAATGG + Intergenic
1111278966 13:85992868-85992890 ACTAGAAAACAGTTTTAAAAAGG - Intergenic
1111300275 13:86340964-86340986 TCTAGAAAATACCCTAAAAAGGG - Intergenic
1111303187 13:86371785-86371807 TCCAGAAAATAGCCTCAAAAGGG - Intergenic
1111513153 13:89292949-89292971 TCTAGAAAATGGCCTCAAAAGGG - Intergenic
1111542908 13:89691275-89691297 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
1111554854 13:89867310-89867332 GCTAGAAAACAAAATTAAAGTGG - Intergenic
1111572906 13:90110020-90110042 TCTTGAGAAGAGACTTGAAATGG + Intergenic
1111581899 13:90233213-90233235 TATAAAAAACAAACTTGAAATGG - Intergenic
1111883570 13:93989520-93989542 TCTAGAACACAGTTTTTAAAAGG + Intronic
1112476634 13:99737206-99737228 TCTAGGAAACACACTTACAGGGG - Intronic
1113013385 13:105796713-105796735 TCTAGAAAATAAATTTAAAATGG - Intergenic
1113212333 13:107998790-107998812 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1113217781 13:108062357-108062379 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1113244070 13:108375572-108375594 TCTAGAAAATAGTCTCAACACGG - Intergenic
1113254072 13:108487424-108487446 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1114072494 14:19125702-19125724 TCTAGAGAATAGCCTCAAAAGGG - Intergenic
1114506476 14:23218674-23218696 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1114714320 14:24808272-24808294 TCTAGAAAATACATCTAAAATGG - Intergenic
1114820423 14:26011187-26011209 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1114921301 14:27333802-27333824 TTTAGAGAACAGACATTAAATGG - Intergenic
1115011269 14:28548266-28548288 TAGAGAAAAGAGACTCAAAATGG - Intergenic
1115134060 14:30087800-30087822 TCTAGAAAATATCCTCAAAAGGG + Intronic
1115178120 14:30589277-30589299 AATAAAAAACAGACATAAAATGG - Intronic
1115275853 14:31607737-31607759 TCTAGGAAATAGTCTCAAAAGGG + Intronic
1115563917 14:34607992-34608014 CCTAGAAAATGGAATTAAAATGG + Intronic
1115918514 14:38344183-38344205 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
1115948815 14:38696040-38696062 TCTAGAATATAGGCTTAAAAGGG + Intergenic
1116021466 14:39467536-39467558 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1116058036 14:39887340-39887362 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
1116085705 14:40235489-40235511 TATAGAAAATAGCCTCAAAAGGG - Intergenic
1116121838 14:40730734-40730756 TTCAGAAAATAGCCTTAAAAAGG - Intergenic
1116220744 14:42084437-42084459 TTTAGAAAATAGCCTCAAAATGG - Intergenic
1116392854 14:44414538-44414560 TCTAGAAAATAGTCTCAAAGGGG + Intergenic
1116466519 14:45239707-45239729 TCTGGAAAACAGACTGAAAAAGG + Intronic
1116481239 14:45393498-45393520 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
1116506812 14:45693046-45693068 TCTATAAAATAGCCTCAAAAGGG - Intergenic
1116556538 14:46317090-46317112 TTTTCAAAAAAGACTTAAAAGGG + Intergenic
1116669283 14:47820537-47820559 TTTAGCAAATAGCCTTAAAAGGG - Intergenic
1116775383 14:49174455-49174477 TCTAGAAATTAGCCTCAAAAGGG + Intergenic
1116889292 14:50251371-50251393 TCTAGAAAACATTCTCAAAAGGG + Intronic
1116930527 14:50686704-50686726 TCTAGAAAACAGTCTTTAAAAGG - Intergenic
1117159207 14:52972292-52972314 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
1117234148 14:53753720-53753742 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
1117557332 14:56899402-56899424 CCTAGAAAACACATTTATAAAGG - Intergenic
1117870993 14:60199944-60199966 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1118034054 14:61847695-61847717 TCTAGAAAATAGTCTTTAAAAGG - Intergenic
1118097039 14:62548202-62548224 TCTAGACAATAGCCTCAAAATGG + Intergenic
1118113984 14:62753345-62753367 TCTGGAAAATAGCCTCAAAACGG + Intronic
1118240998 14:64058799-64058821 TCTAGAAAATAGCCTCAAAAAGG - Intronic
1118481351 14:66170120-66170142 TCTAGAACATAGACTTGACAAGG - Intergenic
1118543701 14:66859973-66859995 TGTAGAAAATAGGCTCAAAAGGG + Intronic
1118796908 14:69152556-69152578 TCTATAAAAAAGACCTAAAATGG - Intronic
1119083669 14:71720584-71720606 GCTAGAAAATAGCCTCAAAAGGG - Intronic
1119096683 14:71839381-71839403 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1120007531 14:79376631-79376653 TTTTGAAAACAGAATTAAAAAGG - Intronic
1120442552 14:84558704-84558726 TCTAGAAAGAGGAGTTAAAAGGG + Intergenic
1120468131 14:84887016-84887038 TCTAGAAAGTAGCCTCAAAAGGG + Intergenic
1120697609 14:87661138-87661160 TCTAGAAAATAGCCTAAAATGGG + Intergenic
1120770910 14:88379624-88379646 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1120808363 14:88776933-88776955 TCTAGAAAATAGTCTCAAAAGGG + Intronic
1121153135 14:91655691-91655713 TCTAGAAATTAGCCTCAAAAGGG + Intronic
1121368377 14:93335018-93335040 TTTAAAAAACAAAATTAAAATGG + Intronic
1121372760 14:93375378-93375400 TCTCAAAAACAAATTTAAAAAGG + Intronic
1121564103 14:94895751-94895773 TGTCAAGAACAGACTTAAAAGGG + Intergenic
1121759000 14:96427760-96427782 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1121943895 14:98100505-98100527 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
1122006551 14:98709167-98709189 TCCAAAAAAGAGAATTAAAAGGG - Intergenic
1202847566 14_GL000009v2_random:194266-194288 CCTAGAAATCCAACTTAAAAGGG + Intergenic
1202917034 14_GL000194v1_random:184808-184830 CCTAGAAATCCAACTTAAAAGGG + Intergenic
1123496044 15:20828061-20828083 CCGATAAAACAGACTTTAAATGG + Intergenic
1123552529 15:21397153-21397175 CCGATAAAACAGACTTTAAATGG + Intergenic
1123588775 15:21834541-21834563 CCGATAAAACAGACTTTAAATGG + Intergenic
1124037301 15:26066473-26066495 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1124945275 15:34259635-34259657 TCTCAAAAACAAACTAAAAATGG + Intronic
1125276824 15:38002487-38002509 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1125566268 15:40681136-40681158 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1126031805 15:44506578-44506600 TCTACAAAACATACAAAAAAGGG - Intronic
1126053098 15:44705503-44705525 TCTAGAAAATAGCCTCAAAACGG - Intronic
1126294837 15:47128401-47128423 TCTAGAGAATAGCCTCAAAAAGG - Intergenic
1126488985 15:49215370-49215392 TCTAGAAAATAGCCTAAAAGGGG - Intronic
1126517463 15:49552619-49552641 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1126571958 15:50162461-50162483 TATAGAAAATAGCCTCAAAAGGG - Intronic
1126709277 15:51439773-51439795 TCTAGAAAACAGCCTCGAAAGGG - Intergenic
1127019133 15:54726344-54726366 TCTAGAAAATAGACTCAGTAGGG - Intergenic
1127035348 15:54909783-54909805 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1127132829 15:55884803-55884825 TCTAGAAAATAGCCTCAAATGGG + Intronic
1127140566 15:55971302-55971324 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1127171059 15:56301333-56301355 TCTAGAAAATAGGCTCAAAAGGG + Intronic
1127177858 15:56381060-56381082 TCTAGAAAATAGGCTCAAAAGGG - Intronic
1127406781 15:58657332-58657354 TCTAGGAAATAGCCTCAAAAGGG - Intronic
1127971334 15:63964591-63964613 TCTAGAAAATAGCCTCAAAAAGG - Intronic
1128966419 15:72062697-72062719 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1129501236 15:76039610-76039632 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1129835297 15:78701332-78701354 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1130400184 15:83545165-83545187 TCTAGAAAATAGCTTCAAAAGGG - Intronic
1130511976 15:84596958-84596980 TCTAGAAAACAGCCTCAGAAGGG + Intergenic
1130941049 15:88509439-88509461 TCATGACCACAGACTTAAAATGG - Intergenic
1131104152 15:89718915-89718937 TCTAGAAAACACACATCAACTGG - Intronic
1131368399 15:91859343-91859365 TCTGGAAAACAGATATAAACAGG + Intronic
1131803969 15:96102326-96102348 TCAAGAAATCATTCTTAAAATGG + Intergenic
1131945077 15:97610547-97610569 TCTAGAAAAGAGCCTCAGAAGGG + Intergenic
1132192652 15:99881555-99881577 TCCAGAAATAAGACATAAAATGG + Intergenic
1132236411 15:100225233-100225255 TCTTAAAAAAAGAATTAAAAAGG - Intronic
1132384980 15:101393884-101393906 TCTGGAAAACATACTTGAAGAGG + Intronic
1202960878 15_KI270727v1_random:124373-124395 CCGATAAAACAGACTTTAAATGG + Intergenic
1133833720 16:9348982-9349004 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1133943870 16:10332507-10332529 TCTAAAAAAAAAAATTAAAAAGG - Intronic
1134282270 16:12827700-12827722 TTGAGAGAACAGATTTAAAAGGG - Intergenic
1134396411 16:13868438-13868460 TTTTTAAAACAGACTTTAAAAGG - Intergenic
1134406850 16:13968396-13968418 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1135204638 16:20472904-20472926 TCTAGAAAACCATCTTAAATTGG - Intronic
1136182434 16:28562984-28563006 CATAGAAAGCAGTCTTAAAAGGG + Intronic
1136244405 16:28965423-28965445 TCTACAAAAAAAAATTAAAAAGG + Exonic
1136375138 16:29860976-29860998 TCTACAAAGCAGAGCTAAAAAGG + Intronic
1136676442 16:31912667-31912689 TTTAGAAAACACCCTGAAAAGGG - Intronic
1137361694 16:47823020-47823042 TCTTGAATAAAGATTTAAAAAGG + Intergenic
1137455233 16:48612878-48612900 TCTAGAATACAGAATTCATAAGG - Intronic
1137462839 16:48680998-48681020 TCCAGAAAACACATTCAAAAAGG - Intergenic
1137886727 16:52112309-52112331 TCTTGACTACAGACTCAAAATGG - Intergenic
1138404327 16:56777227-56777249 TCTTGAAAACACATTTAAAATGG + Intronic
1138638125 16:58360428-58360450 TCTAGAATATAGCCTCAAAAGGG - Intronic
1139058230 16:63214417-63214439 TCTATTATAAAGACTTAAAATGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140105424 16:71955431-71955453 TCTAAAAAACAAACAAAAAAAGG + Intronic
1140234622 16:73147191-73147213 TGAAGAAAACAGGCTTAAAGAGG - Intergenic
1140298824 16:73736538-73736560 TCTGGCAAACAGAAATAAAAGGG + Intergenic
1140646463 16:77037015-77037037 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1140838099 16:78814184-78814206 TCTAGAAGACAGAATTATTATGG - Intronic
1140932332 16:79639476-79639498 TTAAGAAAACAAACTTCAAATGG - Intergenic
1141037486 16:80640952-80640974 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1141712294 16:85707046-85707068 CCTAGACAGCAGACTGAAAATGG + Intronic
1142037729 16:87872237-87872259 TGTTGCAAACAGCCTTAAAAAGG - Intergenic
1142069209 16:88081115-88081137 GCAAGAAAAGAGGCTTAAAAGGG + Intronic
1142919757 17:3173943-3173965 TCTAGAAAATAGTCTCAAAAAGG + Intergenic
1143257144 17:5568195-5568217 TCTAGAAAATAGCCTCAAAATGG - Intronic
1143431445 17:6890084-6890106 TCTAGAAAACAGCCCCAAAGGGG - Intronic
1144447778 17:15346976-15346998 TCTAGACAAGATACTTAATAGGG - Intergenic
1144447998 17:15349024-15349046 TCCAGAAAACAGACTGAAGCTGG + Intergenic
1149108675 17:52999055-52999077 TCCAGAAAATAGCCTCAAAAGGG + Intergenic
1149157207 17:53646438-53646460 TCTAGATAATAGCCTCAAAAGGG - Intergenic
1149239941 17:54637027-54637049 TCTAGAAAATAACCTTAAAGGGG + Intergenic
1149262970 17:54899707-54899729 GCTAAAAAACAGACTTGAAATGG + Intronic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1149906480 17:60530806-60530828 TCTAGAAAATAGCCTAAAAAGGG + Intergenic
1149923844 17:60682940-60682962 TCTAAAAAACAAACAAAAAAAGG - Intronic
1149980669 17:61308757-61308779 GATAGAAAACAGACTTAGTATGG - Intronic
1150824134 17:68459711-68459733 TCTAGAAGATACATTTAAAAAGG + Intergenic
1150870636 17:68906512-68906534 TCTAGAGAACAGATATAAATGGG + Intronic
1151503665 17:74511688-74511710 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1153075149 18:1154633-1154655 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1153141091 18:1973318-1973340 TGCAGAAACCAGACCTAAAATGG + Intergenic
1153388745 18:4531241-4531263 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
1153454007 18:5260819-5260841 TCTAGGAAATAGCCTTAAAGAGG + Intergenic
1153610693 18:6881307-6881329 TCCAGAAAAGATACTTAGAAAGG - Intronic
1153714768 18:7837149-7837171 ACTAGAAAATAGCCTCAAAAAGG - Intronic
1154063136 18:11082281-11082303 TCTATGAAACAACCTTAAAATGG - Intronic
1155214751 18:23633517-23633539 TCTGCACAACAGATTTAAAAGGG + Intronic
1155282311 18:24252072-24252094 TCTAGGAAACAGCCTCAAAAGGG + Intronic
1155390902 18:25335500-25335522 TCTGGAAAACACTTTTAAAAGGG - Intronic
1155443597 18:25886570-25886592 TCTAGAAAATAGACTCAAAAAGG + Intergenic
1155455831 18:26012203-26012225 TCTAGACCACATTCTTAAAACGG - Intergenic
1155597508 18:27504284-27504306 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
1155633986 18:27929129-27929151 TGTTGAAAACAGATTTCAAAAGG + Intergenic
1155767660 18:29654974-29654996 TCTAGAAAATAAACTCAAAAGGG + Intergenic
1155887410 18:31224931-31224953 TCTACAAAACATACTAAAATTGG - Intergenic
1156094428 18:33511759-33511781 TCTAGAAAATAGTCTCAAAAAGG + Intergenic
1156276281 18:35585693-35585715 TTTATAAAACATTCTTAAAATGG - Intronic
1156348020 18:36275423-36275445 TCTGGAAAACAGATCTAAAGAGG + Intergenic
1156356397 18:36345776-36345798 GCTAGAAAACAAACTTACAGAGG + Intronic
1156378909 18:36539751-36539773 TCTAGAAATCATACTCATAATGG - Intronic
1156755733 18:40522557-40522579 TCTAGAATACAGATTAAAATTGG - Intergenic
1156781495 18:40856063-40856085 TCTAAAAAACAAACTCACAATGG - Intergenic
1157022573 18:43804455-43804477 TATAGAAAATAGCCTTAAAAGGG - Intergenic
1157879486 18:51306308-51306330 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1157937148 18:51885400-51885422 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1158117033 18:54006838-54006860 TCTATAAAATAGCCTCAAAAGGG + Intergenic
1158361402 18:56677900-56677922 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1158431459 18:57391062-57391084 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1158847770 18:61462836-61462858 TCAAGAAAACAAAGTTCAAAAGG + Intronic
1158983396 18:62788153-62788175 TAAAGAAAACAAACTTAAAAGGG - Intronic
1159080767 18:63732899-63732921 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1159192237 18:65061434-65061456 TCTTGATAACAGACTCTAAAAGG + Intergenic
1159472404 18:68874281-68874303 TATAGAAAATAGACATAAAAAGG + Intronic
1159718544 18:71856488-71856510 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1159775194 18:72597058-72597080 TTTAGAAAATAGTCTCAAAAGGG - Intronic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1159896321 18:74000288-74000310 TCTAGAAAAGAGCCTCAAAAAGG - Intergenic
1160138334 18:76295100-76295122 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1160289365 18:77576803-77576825 TTTAGAAAACATACTTTAAATGG + Intergenic
1162611071 19:11753586-11753608 TCTAGGAAACAGCCTCAAAAAGG - Intergenic
1162666595 19:12218885-12218907 TCTAGAAGATAGCCTCAAAAGGG - Intergenic
1162692651 19:12446848-12446870 TCTAGAACATAGCCTCAAAAGGG - Intronic
1163185299 19:15634698-15634720 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1163225011 19:15954074-15954096 TATAGAAAATAGCCTCAAAAGGG - Intergenic
1164317031 19:24099535-24099557 TCTACAAAAGTGACTGAAAAGGG - Intronic
1164750203 19:30648129-30648151 CCCAGAACACAGACTAAAAAGGG + Intronic
1165243611 19:34485012-34485034 TCTTGAAAACAAAATAAAAAAGG - Intronic
1166408143 19:42538153-42538175 TCTAGAAAATAGGCTCAAAATGG - Intronic
1166605334 19:44137365-44137387 TATAAAAAACAAATTTAAAATGG + Intergenic
1166621321 19:44303939-44303961 TCTAGAAAGCATACTCAAAAGGG - Intronic
1166757045 19:45199266-45199288 TCTAGAAAATAGCCACAAAAAGG - Intronic
925249434 2:2420022-2420044 TCCAGAAAACTGCCTCAAAATGG - Intergenic
925701524 2:6643684-6643706 TTTAGAAAACTGACTCAAAATGG + Intergenic
926478508 2:13358268-13358290 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
926516441 2:13852213-13852235 TCTAGAACACAGCCTCAAAAGGG + Intergenic
926533072 2:14076117-14076139 TTTAGAAAAAAGACATAGAAGGG + Intergenic
926833782 2:16995382-16995404 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
926941380 2:18140867-18140889 TCTAGGAATCCAACTTAAAAGGG - Intronic
926970377 2:18461709-18461731 TGTAGAAAAAAGAATTAAAGAGG + Intergenic
927399867 2:22698369-22698391 TCTAGAATAGATACTTAAAGTGG - Intergenic
928293731 2:30062635-30062657 TCTAGAAAATAGCCACAAAAAGG + Intergenic
928459053 2:31452494-31452516 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
928472474 2:31588116-31588138 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
928485870 2:31730418-31730440 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
928495506 2:31827840-31827862 TCTAGAAAGTAGACTCAAAAGGG - Intergenic
928840734 2:35601312-35601334 TCCAGAAAAGATACTTGAAAAGG - Intergenic
928863800 2:35894203-35894225 TCTAGAAAATGGCCTGAAAAGGG - Intergenic
928932517 2:36638647-36638669 TCTAGGAAATAGCCTCAAAAGGG + Intronic
929098604 2:38287222-38287244 AATAGAAAAAAGACTTGAAAGGG + Intergenic
929100152 2:38303615-38303637 TCTAGAAAATAGCCCCAAAAGGG + Intronic
929281496 2:40085745-40085767 TCTAGAAAATAGCCTTAAGAAGG - Intergenic
929363076 2:41118884-41118906 TACAGAGAAAAGACTTAAAAAGG + Intergenic
929388485 2:41441002-41441024 TCTAGAAAATAGCCTCAACAGGG - Intergenic
929923526 2:46190817-46190839 AGTAGAAAACAGACTTCATAAGG - Intergenic
930041317 2:47127152-47127174 TCTATAAAATAGCCTCAAAACGG - Intronic
930141722 2:47957423-47957445 TGTAGAAAACAGCCTCAAAAGGG + Intergenic
930205979 2:48587036-48587058 ACTGGGAAACAGACTTTAAAAGG - Intronic
930375132 2:50555663-50555685 TCTAGAAACTAGGTTTAAAAAGG - Intronic
930430301 2:51266841-51266863 TGTAGAAAACAGGCTTTAATAGG + Intergenic
930482249 2:51963708-51963730 TGTAGAAAACACACCTGAAAAGG + Intergenic
930527672 2:52550026-52550048 TCTAGAAAATAATCTTGAAAGGG + Intergenic
930727619 2:54697033-54697055 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
930739379 2:54814415-54814437 TCTAGAAAAGAAAGTAAAAACGG + Intronic
930970353 2:57387271-57387293 CCTAGAAAATAGTCTCAAAAGGG + Intergenic
930972265 2:57409984-57410006 TCTAGAAAATTGCCTCAAAAGGG + Intergenic
931001722 2:57792734-57792756 TCTAGAAAATAGACTCAAAAGGG - Intergenic
931007029 2:57862473-57862495 TCTTAAAAACAGGCTTAAAAAGG - Intergenic
931147403 2:59534227-59534249 GCTAGAAGACAGACTTAATTTGG - Intergenic
931161784 2:59701000-59701022 TCTAGAAAATAGCCTTAAAATGG - Intergenic
931196050 2:60053251-60053273 TCCACACAACAGACTTAAAGGGG + Intergenic
931343827 2:61427837-61427859 TCTAGAAAATAGCCTCAAAAGGG + Intronic
931406693 2:61986522-61986544 TTTAGAAAACAGCCTCAAAAGGG - Intronic
931546301 2:63391808-63391830 TCTAGGAATCAAACTTACAAGGG + Intronic
931568850 2:63647048-63647070 TATAGAAAATAGTCTCAAAAGGG - Intronic
931572440 2:63682537-63682559 TCTAGTAAATAGTCTCAAAAGGG + Intronic
931617528 2:64175360-64175382 TGTAAAAAACAGATTAAAAATGG + Intergenic
932067907 2:68586407-68586429 TTTAGATAAAAGACTAAAAAAGG + Intronic
932648259 2:73528746-73528768 TCTAGAAAATAGCCTCAAAAGGG - Intronic
932920978 2:75915314-75915336 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
933032636 2:77350694-77350716 TCTTGTAAACAGACTAAAACAGG + Intronic
933227364 2:79766670-79766692 TCTAGAAAATAGCCTCAAAAGGG - Intronic
933341495 2:81032263-81032285 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
933393484 2:81702573-81702595 TAAAGAAAATTGACTTAAAAGGG + Intergenic
933424256 2:82089706-82089728 TCCAGAAAAGAAACTGAAAAAGG - Intergenic
933485207 2:82912655-82912677 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
933910073 2:86932046-86932068 TTTAGGAAACAGACTTGGAAGGG + Intronic
934022654 2:87971363-87971385 TTTAGGAAACAGACTTGGAAGGG - Intergenic
934276644 2:91578079-91578101 TCTTAAAAACAGAATGAAAACGG - Intergenic
934870754 2:97862733-97862755 CCTAGAAAATAGCCTCAAAAGGG + Intronic
935152261 2:100448611-100448633 TCCAGAAAACAGATCTCAAATGG + Intergenic
935356428 2:102205874-102205896 TCTAGAAGATAGCCTCAAAAGGG - Intronic
935388743 2:102528429-102528451 TTTAGAAAAAAATCTTAAAAAGG + Intronic
935478442 2:103555643-103555665 TCTAGAAAATAGTCTCCAAAGGG - Intergenic
935810063 2:106788954-106788976 TTTAGGAAAAAGACTAAAAAAGG - Intergenic
935989666 2:108707601-108707623 TTTAGAAAATAGTCTCAAAAGGG + Intergenic
936050593 2:109220260-109220282 TCTAGAAAATTAACTCAAAATGG + Intronic
936399397 2:112154325-112154347 TCTAAGAAAAAGATTTAAAACGG + Intronic
936413623 2:112283655-112283677 TTTAGGAAACAGACTTGGAAGGG + Intronic
936511086 2:113147929-113147951 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
936585587 2:113755296-113755318 TCTAAAAAACAGACTGCAAATGG - Exonic
936596061 2:113849243-113849265 ACCAGAAACCAGGCTTAAAAGGG + Intergenic
936636587 2:114265766-114265788 CCTATAAAACAGAGTTAAAAGGG - Intergenic
936825242 2:116574575-116574597 TCTAGAAAATAACCTCAAAAGGG - Intergenic
936885199 2:117301525-117301547 TCTAGAAAATAGCCTAAAAAGGG + Intergenic
937512662 2:122613256-122613278 TCTAGAAAATAGCCTCAAATTGG + Intergenic
937552018 2:123106442-123106464 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
937560762 2:123220812-123220834 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
938177782 2:129152004-129152026 TGTAGAAAATAGCCTCAAAATGG - Intergenic
938338519 2:130520135-130520157 TCTAAAAAACAAAATTAACAAGG + Intergenic
938351320 2:130600615-130600637 TCTAAAAAACAAAATTAACAAGG - Intergenic
939136293 2:138298385-138298407 ACTAGTAAATAGGCTTAAAAAGG + Intergenic
939149163 2:138452924-138452946 ACTGAAAAACAGATTTAAAATGG - Intergenic
939218762 2:139275073-139275095 TTAAGAAAACAGAGTCAAAAAGG + Intergenic
939273753 2:139972464-139972486 TCTAGAAAACAGCCTTAAAAGGG + Intergenic
939285952 2:140129920-140129942 ACTAGAAAACATTATTAAAATGG + Intergenic
939443034 2:142274608-142274630 TCTAGAAAGTAGCCTTAAAAGGG - Intergenic
939604235 2:144233868-144233890 TTTAAAAAACAGACTTAAAAAGG + Intronic
939707740 2:145476609-145476631 TCTAGAAAATAGCCCCAAAAGGG - Intergenic
939800592 2:146701935-146701957 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
940402188 2:153260837-153260859 TTTAGAAAATAGCCTCAAAAGGG - Intergenic
940429613 2:153574491-153574513 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
940461313 2:153966873-153966895 TCTAGACAATAGCCTCAAAAGGG - Intronic
940468826 2:154066227-154066249 TCTAGAAAATAGCCTCAGAAGGG + Intronic
940730695 2:157387044-157387066 TCTAGGAAATAGCCTCAAAAGGG + Intergenic
940738644 2:157481656-157481678 TCTAGAAAATAGCCTTAAAAGGG + Intronic
940786190 2:157983895-157983917 TCTAGAAAATAGCTTCAAAAGGG - Intronic
940795567 2:158073338-158073360 TCTAGAAAACAGCCTCAAAAGGG + Intronic
940803202 2:158155587-158155609 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
940947928 2:159638752-159638774 TCTAGAAAATAGCGTCAAAAGGG + Intergenic
941233937 2:162945586-162945608 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
941302870 2:163826453-163826475 TCTAGGAAATAGCCTCAAAAGGG - Intergenic
941505878 2:166344695-166344717 TCCAGAAAAGAGACATGAAAAGG - Intronic
941528088 2:166630902-166630924 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
941559672 2:167029067-167029089 ACTAGAAAATAGTCTCAAAAGGG + Intronic
941678767 2:168372587-168372609 TCTAGAAAACAGCTTCTAAAGGG + Intergenic
941745793 2:169086126-169086148 TCTAAAAAATAGCCTCAAAAGGG - Intronic
941748770 2:169113813-169113835 TCTAGAAAAAGGAGTTAGAAAGG - Intergenic
941851625 2:170189466-170189488 TCTAGAAAGTAGCCTCAAAAGGG - Intronic
942295181 2:174509920-174509942 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
942352498 2:175066923-175066945 TCTAGAAAACAGCCTCAATAGGG + Intergenic
942391620 2:175501110-175501132 TCTAGAAAATAAGCTTAAAAAGG - Intergenic
942750289 2:179278800-179278822 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
942846048 2:180426856-180426878 TCTAGAAAGTAGCCTCAAAAAGG + Intergenic
942882194 2:180873689-180873711 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
942915162 2:181295984-181296006 TCTAGAAAATACCCTCAAAAGGG + Intergenic
942975551 2:182013672-182013694 TCTAGAAAATAGCCTCAAAAGGG - Intronic
943128065 2:183821217-183821239 TCTAGAAAATAGGCTCAAAAGGG + Intergenic
943237087 2:185336698-185336720 TCTAAAAAATAGCCTCAAAAGGG - Intergenic
943255083 2:185584469-185584491 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
943427726 2:187757817-187757839 TCTAGAAATTAGCCTCAAAAGGG - Intergenic
943839153 2:192555618-192555640 CCTAGAAAACAGATTTTAAAAGG - Intergenic
943845266 2:192636721-192636743 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
943915723 2:193629372-193629394 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
943967476 2:194355187-194355209 TCTAGAAAATAGCCTCAAACGGG + Intergenic
944021437 2:195109870-195109892 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
944021505 2:195110785-195110807 CCTAGAAAACAGTTTCAAAAGGG - Intergenic
944044883 2:195399252-195399274 ACTAGAAAACAGAATCAAAAAGG + Intergenic
944078811 2:195761334-195761356 TCTAGAAAATAGCCTTAAAAGGG + Intronic
944096884 2:195977498-195977520 TCTGGAAAATAGCCTCAAAAGGG + Intronic
944133088 2:196368617-196368639 TCTAGAAAACAGCCTCAAAAGGG - Intronic
944305101 2:198170036-198170058 TCTAGAAAACATACTTCAATGGG - Intronic
944616210 2:201463732-201463754 TCTAGAAAACAGCCTCAAAAGGG - Intronic
944751792 2:202716652-202716674 TCTAGAAAATAGCCTCAGAAGGG - Intronic
944854849 2:203758034-203758056 TCTAGAAAACAGCTTTGGAAGGG - Intergenic
944909949 2:204300753-204300775 CTTAGAAACCAGACTTCAAATGG + Intergenic
944963197 2:204900253-204900275 TCTAGAAAATACCCTCAAAAGGG - Intronic
945217808 2:207453623-207453645 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
945226709 2:207538562-207538584 TCTAAAAAATAATCTTAAAAGGG + Intronic
945534947 2:211004707-211004729 TCTGTAAAATAGACGTAAAATGG + Intergenic
945739546 2:213643651-213643673 TCTAGAAAATAGCCTCCAAAGGG - Intronic
945754290 2:213828160-213828182 CCTAGAAAATAGGCTCAAAAGGG - Intronic
946508917 2:220333565-220333587 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
946697440 2:222373770-222373792 TATAGAAAATAGCCTCAAAAGGG + Intergenic
946882403 2:224189730-224189752 TCTAGAAATCAGACAGAAATGGG + Intergenic
947039400 2:225898398-225898420 TCCAGAAAATAGCCTCAAAAGGG + Intergenic
947209005 2:227689119-227689141 CCTAGAAAACAGCCTCAAAAAGG + Intronic
947240673 2:227990999-227991021 TCAGGAAAACAGAATTGAAAAGG - Exonic
947312172 2:228816835-228816857 TGTAGAAAATAGCCTCAAAAGGG - Intergenic
947439572 2:230107728-230107750 TCTAGGAAATAGCCTCAAAATGG - Intergenic
947892899 2:233642149-233642171 TCTAGAAAATAGCCTCAAAGGGG - Intronic
948112436 2:235467095-235467117 TCTAATAAACAGGCTTCAAATGG + Intergenic
948475324 2:238215000-238215022 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1168743975 20:220280-220302 TGTAGAAAATAGTCTCAAAAGGG + Intergenic
1168862446 20:1055498-1055520 ACTAGAAAACAGAAATAAATAGG + Intergenic
1168899831 20:1354001-1354023 TCTAGAAAATAGCCTCCAAAGGG - Intronic
1168917065 20:1498743-1498765 TCTAGAAAATAGCCTCCAAAAGG - Intergenic
1169389240 20:5176089-5176111 TCTAGAATAAAAAGTTAAAAAGG + Intronic
1169624025 20:7541992-7542014 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1169628842 20:7602081-7602103 TCTAGAAAATAGCCACAAAAGGG + Intergenic
1169988908 20:11476390-11476412 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
1170236217 20:14107400-14107422 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1170489597 20:16859197-16859219 ATTAGAATACAGACATAAAAGGG - Intergenic
1170668543 20:18407931-18407953 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1170709022 20:18773598-18773620 TCTGGAAAATAGCCTCAAAAGGG - Intergenic
1170766388 20:19292929-19292951 TCTATAAAAGAGACTCCAAAGGG - Intronic
1170913728 20:20601834-20601856 TCTAGAACACAGCCTGATAAAGG + Exonic
1171358314 20:24567519-24567541 TCTTGAAAAGAGCCTTGAAAAGG + Intronic
1171938133 20:31295328-31295350 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
1172825881 20:37785404-37785426 TCTAGACAATAGCCTCAAAAGGG - Intronic
1172953919 20:38741837-38741859 TCTAGAAAAGAGAGTAAAAGTGG - Intergenic
1173204039 20:40978495-40978517 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1173207793 20:41008084-41008106 TCTAGGAAATAGACTTGGAATGG - Intergenic
1173348787 20:42225535-42225557 GCTAGGAAAAAAACTTAAAAAGG - Intronic
1173830502 20:46082809-46082831 TCTAGAAAACATGCTGGAAATGG + Intronic
1174691030 20:52504717-52504739 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1174747527 20:53078428-53078450 TCTTGAAAAAAGACATGAAATGG + Intronic
1174897529 20:54466802-54466824 TCTGGAAAACAGAGATAAATGGG - Intergenic
1174981931 20:55406545-55406567 TCTGGAAAATAGCCTCAAAAGGG - Intergenic
1175018268 20:55815206-55815228 TCTAGGAATCCGACTTACAAGGG - Intergenic
1175632009 20:60549033-60549055 TCTAGGAAATAGCCTCAAAAGGG - Intergenic
1175745019 20:61450404-61450426 CTGTGAAAACAGACTTAAAAAGG - Intronic
1176670326 21:9728137-9728159 TCTAGGAAACAGAAGAAAAATGG + Intergenic
1176876798 21:14137584-14137606 TCTAGAAAATAGCCTTAAAAGGG + Intronic
1176917731 21:14646014-14646036 TCTAGAAAATTGCCTCAAAAGGG + Intronic
1177121904 21:17147526-17147548 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1177275820 21:18911996-18912018 TCTAGAAAACAGCCTCAATAGGG - Intergenic
1177302115 21:19261209-19261231 CACAAAAAACAGACTTAAAAAGG + Intergenic
1177559039 21:22727248-22727270 TCTAGAAAACAATCTTTTAAGGG + Intergenic
1177771485 21:25520729-25520751 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1177970224 21:27779513-27779535 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1178047231 21:28709272-28709294 TGTAGAATACAGAGTTAATATGG + Intergenic
1178362836 21:31963986-31964008 TGTAGAAGAGAGACTTAGAAAGG - Intronic
1180209044 21:46282890-46282912 TCTAGAGGACAGACTGACAAGGG + Intronic
1181516092 22:23414688-23414710 TCTGGAAAACAGACCACAAAAGG - Intergenic
1181717107 22:24739206-24739228 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1182178885 22:28323616-28323638 TCTAGAAAACAGCCCCAAAAGGG + Intronic
1182182078 22:28360219-28360241 TATAAAAAACAGATTAAAAAGGG + Intronic
1183195681 22:36352006-36352028 ACTAGGAAACAGACTCAGAAAGG + Intronic
1184862677 22:47183173-47183195 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1184954665 22:47877851-47877873 AATAGAAAACAGACTTCACAAGG + Intergenic
949235525 3:1804736-1804758 TCTAGAAAATAGACTCAAAAAGG - Intergenic
949375652 3:3386757-3386779 TCTAGAAATCAGAGTTTAATAGG + Intergenic
949428678 3:3948175-3948197 TCTAGAAAATAGCCTCAAAAGGG - Intronic
949448328 3:4160198-4160220 TCTAGAAAATAGATTCAAAAGGG - Intronic
949452676 3:4204621-4204643 TCAAGAAAAGAGCCTCAAAAGGG - Intronic
949777240 3:7646880-7646902 TCCAGAATACAGACTTTACATGG - Intronic
949829073 3:8195467-8195489 CCTAGAAAACAGACTAAAAAGGG - Intergenic
950695387 3:14697318-14697340 TCTAGAAAATAACCTCAAAAGGG - Intronic
950920774 3:16692355-16692377 TCTAGAATACAGAATCTAAAGGG - Intergenic
951029114 3:17861967-17861989 TCTAGAAAAGAGCCTCAAAAGGG - Intronic
951032072 3:17894056-17894078 TCTAGAAAATAGACTCAAGAGGG - Intronic
951102475 3:18704795-18704817 TCTAAAAAATAGCCTTAAAAGGG + Intergenic
951398858 3:22204859-22204881 TCTAGAAAATAGCCTCAAAAGGG + Intronic
951435294 3:22656045-22656067 TCTAGAAAATAGCCTCAAATGGG - Intergenic
951494845 3:23315095-23315117 TCTAGAAAATATCCTTAAAAGGG - Intronic
951595245 3:24311691-24311713 TCCAGAAGAGAGATTTAAAAGGG - Intronic
951794382 3:26522525-26522547 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
951972927 3:28468312-28468334 TCTAGAAAATAGCCTCAAGAGGG + Intronic
952008712 3:28874587-28874609 TCTATAACACAGCCTCAAAAGGG - Intergenic
952149242 3:30568460-30568482 TCTAGAAAATAGGCTCAAAAAGG + Intergenic
952202971 3:31150297-31150319 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
952222141 3:31333603-31333625 TTTAGAAAACAGCCTCAAAAGGG + Intergenic
952517823 3:34123797-34123819 TTTAGAAAATAGCCTCAAAAGGG - Intergenic
952590672 3:34949831-34949853 TGTAGAGAAGAGACTTCAAAGGG + Intergenic
952725905 3:36583958-36583980 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
952811674 3:37409860-37409882 TCTAGAAAATAGCCTCCAAAAGG - Intronic
952941896 3:38452052-38452074 CCTAGAAAAGACACTTAAACTGG + Intergenic
952985409 3:38775540-38775562 CCTATGAAACAGACTTTAAAAGG - Intronic
953251148 3:41246740-41246762 CCTAGAAAACTGACTCAGAATGG - Exonic
953722844 3:45371239-45371261 TCAAGAAAATAGCCTCAAAATGG + Intergenic
955274191 3:57531976-57531998 TCTAGAAAATAGCCTCCAAAGGG - Intronic
955399472 3:58581239-58581261 CCAAGAAATCAGAGTTAAAAGGG - Intronic
955585048 3:60469293-60469315 TCTACAAAATAGCCTCAAAAGGG - Intronic
955686289 3:61552067-61552089 TCAACAAAATAGACATAAAAGGG - Intergenic
955905445 3:63803108-63803130 TAAAGAGAACAGATTTAAAAGGG - Intergenic
956223130 3:66924972-66924994 TCTGGGAAACAGCCTCAAAAGGG + Intergenic
956476287 3:69623244-69623266 TCTAAAAAATAGCCTCAAAAAGG + Intergenic
956540901 3:70338674-70338696 CCTAGGAAACAAACTTACAAGGG + Intergenic
956972958 3:74548627-74548649 TCTTGAAAACTGACTTTAAGTGG + Intergenic
957310207 3:78509515-78509537 TATAGAAAACAGGTTTAAACTGG - Intergenic
957331973 3:78776911-78776933 TATACAAGACACACTTAAAAAGG + Intronic
957890026 3:86344971-86344993 GCTAGAAAATAGGCTCAAAACGG - Intergenic
957977253 3:87462147-87462169 TCTAGAAAATAGCCTTCAAAGGG + Intergenic
958078511 3:88714181-88714203 TCTAGAAAATACCCTCAAAAGGG + Intergenic
958085146 3:88796909-88796931 TGTAGAAAATAGCCTAAAAAGGG - Intergenic
958141344 3:89566065-89566087 TCTAGAAAATAGCCCTAAAAAGG + Intergenic
958174764 3:89982953-89982975 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
958174845 3:89984265-89984287 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
958632139 3:96698570-96698592 TCTAGAATATAGACTCAAAGGGG - Intergenic
958670301 3:97196123-97196145 TCTAGAAAATAGCCTCAAAAGGG - Intronic
958683004 3:97354605-97354627 TCTAGAAAATAGCCAAAAAAGGG + Intronic
958756739 3:98258812-98258834 TCTAGAAAACAGCCTCCAAAGGG - Intergenic
958757571 3:98269650-98269672 TCTAGAAAACATCTTCAAAAGGG - Intergenic
958847355 3:99280332-99280354 TCTAGAAAATAACCTCAAAATGG + Intergenic
958932655 3:100224588-100224610 TCTATAATTCAGCCTTAAAAAGG + Intergenic
959127682 3:102309451-102309473 GCTAGAAAATAGTCTCAAAAAGG + Intronic
959279372 3:104318131-104318153 TGTAGAAAATAGTCTCAAAAGGG + Intergenic
959306639 3:104675407-104675429 TTTAAACAACATACTTAAAAGGG - Intergenic
959643882 3:108675142-108675164 TCTAGAAAAGAGATTTCATATGG - Intronic
960353895 3:116627776-116627798 TCTAGAAAATAGTCTTAAAAGGG - Intronic
960565115 3:119124667-119124689 TCTAGAAAATAGTTTCAAAAGGG + Intronic
960784842 3:121361430-121361452 TCTGGAAAATAGCCTCAAAAGGG - Intronic
961610680 3:128134882-128134904 TCTAGCAAATAGCCTCAAAAGGG + Intronic
961952466 3:130763944-130763966 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
961964253 3:130886481-130886503 TCTAGAAAATAGCCTTAAAAGGG - Intronic
962015331 3:131433196-131433218 TATAGAAAATAGCCTCAAAAGGG + Intergenic
962667980 3:137675058-137675080 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
962688542 3:137870289-137870311 TCTAGAATATAGCCTCAAAAGGG + Intergenic
962868643 3:139469264-139469286 TCCAGAAAACACATTTAGAAAGG + Intronic
962998523 3:140654455-140654477 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
963170482 3:142245717-142245739 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
963179676 3:142340425-142340447 TCTAGAAAACAGCCTCAAAAGGG + Intronic
963310268 3:143701663-143701685 TCTAGGAAATAGCCTCAAAAGGG + Intronic
963365206 3:144325100-144325122 TCTAGAAAATAGCCTCGAAAGGG + Intergenic
963448221 3:145441501-145441523 TCTGGAAAATAGCCTCAAAAAGG + Intergenic
963528554 3:146445788-146445810 TCCAGAAAACAGCCTCAAAACGG - Intronic
963558072 3:146821264-146821286 ACCAAAGAACAGACTTAAAAGGG + Intergenic
963672957 3:148275104-148275126 CCTAGAAAACAGCCTCAAAAGGG + Intergenic
964034234 3:152176804-152176826 TTGATAAAACAGACTTAAAAGGG - Intergenic
964140670 3:153395613-153395635 TCTAGAAAATAACCTCAAAAGGG - Intergenic
964179569 3:153866788-153866810 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
964209071 3:154208582-154208604 GCTAGAAAACAGCCTCAAAAGGG - Intronic
964318290 3:155466993-155467015 TCTAGAAAATAGCCTCAAAAGGG + Intronic
964339145 3:155689779-155689801 TCTAAAAAATAGCCTCAAAAGGG + Intronic
964349988 3:155792830-155792852 TCTAGAAAATAGCCTCAAAGGGG + Intronic
964686976 3:159405963-159405985 TCTAGAAAATAGCCTCAAGAGGG + Intronic
964804236 3:160589053-160589075 TCTAGAAATTAGCCTCAAAAGGG + Intergenic
964810254 3:160655482-160655504 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
964904443 3:161701885-161701907 TCTTGAAAACAGCCTCAAAAGGG + Intergenic
965025247 3:163293149-163293171 TAAAGAAAACAGAAATAAAAAGG + Intergenic
965040148 3:163497524-163497546 TCTAAATAACAGAATAAAAAGGG - Intergenic
965059851 3:163771848-163771870 TCTAGAAAGTAGCCTCAAAAAGG - Intergenic
965257119 3:166427193-166427215 TCTAGAAAATTGGCTCAAAAGGG + Intergenic
965260622 3:166479319-166479341 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
965317529 3:167210408-167210430 CCTAGAAAACACTCTTAAAAGGG + Intergenic
965349206 3:167593244-167593266 TCTAGAAAACAGTCTCAACAAGG - Intronic
965358859 3:167711516-167711538 TCTAGAAAATAGTCTCAAAATGG + Intronic
965527034 3:169731799-169731821 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
965975185 3:174612430-174612452 TCTAGAAAATAGTCTTCAAAAGG - Intronic
965980471 3:174683259-174683281 TCTAGAAAGTAGCCTCAAAAGGG + Intronic
966257305 3:177931643-177931665 TTGAGAAATCAGATTTAAAAAGG - Intergenic
966312837 3:178613946-178613968 TCAAGAAAATAGCCTCAAAAGGG - Intronic
966347845 3:178998762-178998784 TCTATAAAACAAACTGATAATGG - Intergenic
966349479 3:179015758-179015780 TCTAGAAAACAGGGTTAGAGAGG + Intergenic
966441048 3:179944705-179944727 TGTTGAAAACGGCCTTAAAATGG - Intronic
966468283 3:180257157-180257179 TCTAGCAAATAGCCTCAAAAGGG + Intergenic
966518676 3:180848511-180848533 TTTAGAATAGAGTCTTAAAATGG - Intronic
966781479 3:183588054-183588076 TGTAGAAAACAGACTAAACAGGG + Intergenic
967636773 3:191810325-191810347 TCTAGAAAATAGCCTCAAAATGG + Intergenic
967655700 3:192045338-192045360 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
967789624 3:193533331-193533353 TATAGAAAACAAACATAAGAAGG + Intronic
968263880 3:197347397-197347419 TATAAGAAACAGACTTTAAATGG - Intergenic
968428957 4:543659-543681 TCTAGAAAATAGCCTCAAATGGG - Intergenic
969175451 4:5395490-5395512 TCTAGAAAAAAGACTAATAGAGG - Intronic
969915914 4:10491629-10491651 TCAAGGACACAGACTTGAAATGG + Intronic
970295227 4:14622610-14622632 TCTAGAAAAGGGACTTAATTTGG - Intergenic
970307331 4:14747324-14747346 CCTAGAAGACAAACTTATAAAGG + Intergenic
970413260 4:15831929-15831951 TCTAGAAAATTGCCTTAAAAGGG - Intronic
970878608 4:20901914-20901936 TCTAAAAGAAAGACTTTAAAAGG - Intronic
970915374 4:21327686-21327708 TCTGGAAAATAGCCTCAAAAGGG - Intronic
971554237 4:27992702-27992724 TCAAGAAAATGGACTTTAAAAGG - Intergenic
971567663 4:28166695-28166717 TATAGAAAATAGCCTTAAAAGGG - Intergenic
971891608 4:32530592-32530614 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
972021774 4:34324551-34324573 TCTAGAAAATAACCTCAAAAGGG + Intergenic
972125787 4:35763138-35763160 ACTAGAAAACATACTGCAAATGG - Intergenic
972142981 4:35984495-35984517 TCTAGAAAATAGCCTTAAAAGGG + Intronic
972207943 4:36800175-36800197 TCTAGAAAATACCCTTAAAAGGG + Intergenic
972253994 4:37334059-37334081 GCTAGAAAATAGCCTCAAAAGGG + Intronic
972265412 4:37454451-37454473 ATTAAAAAACATACTTAAAATGG - Intronic
972270627 4:37508348-37508370 TCTAGAAAATAGCCTCAAAAGGG - Intronic
972275966 4:37558261-37558283 TCCAAAAAACAAACGTAAAAAGG - Intronic
972278272 4:37579913-37579935 TCTAGAAAATAGCCTCAAAAGGG - Intronic
972902198 4:43699170-43699192 TCTAAAAAATACCCTTAAAAAGG - Intergenic
972902576 4:43702756-43702778 TCTAGAAAATAGCTTCAAAAAGG - Intergenic
972905881 4:43746575-43746597 TCTAGAAAACGGACTGGACATGG - Intergenic
972909708 4:43798941-43798963 TCTATAAAAGAGCCTTAAAAGGG + Intergenic
972928595 4:44042175-44042197 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
973074147 4:45901809-45901831 TCTAGAAAATAGCCATGAAATGG + Intergenic
973327273 4:48876485-48876507 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
973763438 4:54141526-54141548 TATAGAAAATAGCCTTAAAAGGG + Intronic
974200816 4:58637757-58637779 CCTATAAAACAGTCTTATAAAGG + Intergenic
974215391 4:58840734-58840756 TCTAGAAAACAGAACACAAAGGG + Intergenic
974290756 4:59926804-59926826 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
974301178 4:60068737-60068759 TCTAGAAAATAGCCTCAAGAGGG + Intergenic
974926820 4:68309673-68309695 ACTAGAAAACAATTTTAAAATGG - Intergenic
975252888 4:72199630-72199652 CCTAAAAAACAGACTCAAAAGGG + Intergenic
975265579 4:72362197-72362219 TGTGGAATACAGACTTAAATAGG - Intronic
975285596 4:72615432-72615454 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
975316004 4:72953931-72953953 TCTATAGCACAGACTTTAAATGG - Intergenic
975335636 4:73171918-73171940 TCCAGAAAACAGCCTCAAAATGG + Intronic
975339863 4:73227011-73227033 ACTGGAAAACAGAATTAAAGGGG - Intronic
975463384 4:74681946-74681968 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
975486807 4:74942777-74942799 TGTAGAAAACAGACCTAAGAGGG - Intronic
975502099 4:75098681-75098703 TCTAGAGAATAGCCTTAAAAGGG - Intergenic
975623056 4:76313942-76313964 TTTAGTAAACAGACTAAAAAAGG + Intronic
975629926 4:76389463-76389485 TCTAGAAAATAGCCTCAAAAGGG + Intronic
975675080 4:76819833-76819855 TCTACAAAACAGCCTCAAAAGGG - Intergenic
975789023 4:77927857-77927879 TCTAGAAAACAAGCTTAGATTGG - Intronic
976016583 4:80561812-80561834 TCTAGAAAATAGCCTCAAAAGGG + Intronic
976041239 4:80887079-80887101 TCTAGAAAATAGCCCCAAAAGGG + Intronic
976728329 4:88238562-88238584 TCTAGAAATTAGCCTTAAAGGGG - Intergenic
977246868 4:94642343-94642365 TCTAAAAAACTTACTTAATATGG + Intronic
977325523 4:95570985-95571007 TATAGAAAATAGCCTCAAAAGGG - Intergenic
977399350 4:96511505-96511527 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
977468300 4:97409541-97409563 TCCAGAATCCAGACTGAAAATGG - Intronic
977753525 4:100636940-100636962 TCTAGAAAAGTGCCTCAAAAGGG + Intronic
977873467 4:102122166-102122188 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
978008461 4:103649477-103649499 TCTAGAAAACAGCCTCAAAGGGG - Intronic
978192379 4:105929259-105929281 TTTTGAAAACATACTCAAAATGG + Intronic
979122695 4:116923494-116923516 TCTAGAAAACAGCCTCAAACAGG - Intergenic
979213122 4:118131210-118131232 TCTAGAAAATAGCCTCCAAAGGG - Intronic
979218959 4:118199195-118199217 TCTAGAAAATAGCCTCAAAAGGG - Intronic
979269547 4:118743927-118743949 TCTAAACAACAAAATTAAAATGG + Intronic
979360709 4:119761255-119761277 TATAGAAAACAGAATTACCAGGG - Intergenic
979396891 4:120199275-120199297 TCTAGAAAATAGCCTCGAAAGGG + Intergenic
979573167 4:122253650-122253672 TCTAGAAAATAGCCTCAAAAGGG + Intronic
979795478 4:124841179-124841201 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
979838150 4:125400397-125400419 TCAAGAGAACAGTATTAAAAGGG - Intronic
980048541 4:128015319-128015341 TGATGAAAACAGACTTAAGATGG - Intronic
980054901 4:128069945-128069967 TCTATATAACTTACTTAAAATGG - Intronic
980146252 4:128987683-128987705 TCTTTAAAACAGTCTTAAAGGGG + Intronic
980155951 4:129105494-129105516 TCTATATAAAAGATTTAAAAAGG + Intronic
980172257 4:129304529-129304551 TCTGGAAAAGAGTCTCAAAAGGG - Intergenic
980347364 4:131637800-131637822 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
980655606 4:135780046-135780068 ACTAGAAAAAATACTTAAAGGGG + Intergenic
980683081 4:136188699-136188721 TCTAGGAAATAGCCTCAAAAGGG + Intergenic
981154791 4:141422241-141422263 TCTAGAAAACAGTCTCAAAAGGG - Intergenic
981210206 4:142094457-142094479 TCTGAAAAACAGACTAAGAATGG + Intronic
981257964 4:142685829-142685851 TCAAGACAACTGACTTAAATAGG + Intronic
981329375 4:143490056-143490078 TCTAGAAAATAGCCTCTAAAAGG + Intergenic
981394864 4:144235432-144235454 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
981518086 4:145632646-145632668 TTTAGAAAATAGCCTCAAAAGGG - Intronic
981895815 4:149797419-149797441 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
982340007 4:154286709-154286731 TCTAGAAAATAGCCTCAAAAGGG + Intronic
982471437 4:155795754-155795776 TTTAGAAATCAGAACTAAAAAGG + Intronic
982615465 4:157635112-157635134 TCTAGCAAACAGCCTCAAAAGGG + Intergenic
983017397 4:162629857-162629879 GCTAGAAAATAGCCTCAAAAGGG + Intergenic
983321387 4:166200366-166200388 TCTAGAAAAAAGAGGTAAATAGG + Intergenic
983456428 4:167970136-167970158 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
983493292 4:168413733-168413755 TATAGAAAATAGCCTCAAAAGGG + Intronic
983594086 4:169446942-169446964 TCTAAAAAACAGACTCAGAAGGG + Intronic
983755547 4:171330133-171330155 TCTACAAAATAGCCTCAAAAGGG + Intergenic
983865666 4:172762522-172762544 TGGAGAAAACAGACTAGAAAAGG - Intronic
984355265 4:178651165-178651187 TCTAGAAAATAAGCTCAAAAGGG - Intergenic
984424787 4:179569389-179569411 TCTAGAAAACAGCCACAAAAGGG - Intergenic
984442278 4:179787403-179787425 TCTAGAAATCTGTTTTAAAAGGG + Intergenic
984915601 4:184720385-184720407 TCTAGAAAAAAGCTTCAAAAGGG + Intronic
985229652 4:187800723-187800745 TCTAGAAAATATCCTCAAAAGGG + Intergenic
986098958 5:4587507-4587529 TCAAGAAAACATATCTAAAAAGG - Intergenic
986548490 5:8925813-8925835 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
986657412 5:10029243-10029265 TCTAGAAAATAGCTTCAAAAGGG - Intergenic
986804657 5:11298334-11298356 TCTACAAAAAATACATAAAATGG - Intronic
986899202 5:12411557-12411579 TCTAAAAAACAGCCTCAACAGGG - Intergenic
987421883 5:17729826-17729848 TTTAAAAGACAGATTTAAAATGG + Intergenic
987496426 5:18651475-18651497 TCTAGGAAATAGTCTTAAAATGG - Intergenic
987616275 5:20278017-20278039 TCTAGAAAATAGCCTAAAAAAGG + Intronic
987631621 5:20479617-20479639 TCTAGAAAATAGTCTTAACAGGG + Intronic
987687990 5:21229694-21229716 TCTAGAAATCCAACTTACAAGGG + Intergenic
987789526 5:22547062-22547084 TCTATAAAACAGCCCTCAAATGG - Intronic
987953000 5:24700793-24700815 TCTAGAAAACAGACTCCAAAGGG - Intergenic
988039679 5:25873415-25873437 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
988118076 5:26922090-26922112 TCTAGAAAACTGCCTCAAAAGGG + Intronic
988288443 5:29252729-29252751 TCTTGAAAACACTGTTAAAATGG - Intergenic
988299650 5:29405427-29405449 TCCAGAAAATAGCCTCAAAAAGG + Intergenic
988376402 5:30440790-30440812 TATAGAAAATAAACTTAAAAGGG + Intergenic
988608165 5:32700337-32700359 TCTAGAAAATAGCCTTAGAGGGG - Intronic
988939574 5:36129106-36129128 TCTAGAAAATAGCCTCAAAAGGG + Intronic
988955897 5:36318634-36318656 TCTAGAAAATAGCCTCGAAAGGG + Intergenic
989083108 5:37647009-37647031 TCTAGAAAACAGCCTCAAAAGGG - Intronic
989148677 5:38275183-38275205 CCTAGAAAACAATTTTAAAATGG + Intronic
989357319 5:40558993-40559015 TTTATAACACAGACTTCAAAAGG - Intergenic
989472201 5:41833005-41833027 TCTAGAAAATAGCCTCGAAAGGG + Intronic
989657546 5:43760629-43760651 TCTACAAAATAGCCTCAAAAGGG - Intergenic
989671515 5:43923324-43923346 TCTAGAAAATGGCCTCAAAAGGG - Intergenic
989672764 5:43937671-43937693 TCTAGAAAATAGCCTGAAAGGGG + Intergenic
989970585 5:50520042-50520064 TCTAGAAAATATCCTCAAAAGGG - Intergenic
990156326 5:52881420-52881442 TCTAGAGGCCAGACTGAAAATGG - Intronic
990214059 5:53511857-53511879 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
990368823 5:55096264-55096286 GCTAGAAAACAGACAGGAAATGG - Intergenic
990593112 5:57285364-57285386 TCTAAAAAATAGCCTCAAAAGGG + Intergenic
990613794 5:57486617-57486639 TCTGGAAAAGAGAGATAAAATGG + Intergenic
990853963 5:60241674-60241696 TCTAGAAAATAGCCTCAAAAGGG + Intronic
990892599 5:60664654-60664676 TGTAGAAAAAGGACTTCAAAAGG + Intronic
990923648 5:60994832-60994854 TCTAGAAAATAGCCTGAAAAGGG - Intronic
991014105 5:61913077-61913099 TCCAGAAAACAGACGTAAACAGG + Intergenic
991107307 5:62859657-62859679 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
991172957 5:63649671-63649693 TCTATAATACAGTCTTAATAGGG + Intergenic
991237923 5:64420376-64420398 TCTAGACAATAGCCTCAAAAAGG + Intergenic
991275145 5:64838456-64838478 TATAGAATAGTGACTTAAAAAGG - Intronic
991395078 5:66196856-66196878 TCTAGGAAATAGCCTTGAAAGGG - Intergenic
991419895 5:66430057-66430079 TCTGGGAAACAGGCTTATAAAGG - Intergenic
991681846 5:69148038-69148060 TCTAGAAGAAAGTCTCAAAAGGG - Intergenic
991693575 5:69249112-69249134 TCTAGAAGACAGGCTCAAAAGGG - Intronic
992291553 5:75284764-75284786 TCTAGAAAACAGCCTCCAAAGGG + Intergenic
992345366 5:75870511-75870533 TCTAGAAAATAATCTCAAAAGGG + Intergenic
992495718 5:77291218-77291240 GGTTGTAAACAGACTTAAAAAGG + Intronic
992579273 5:78154590-78154612 TCTAGAAAATAGTCTCAAAAGGG - Intronic
992587400 5:78254209-78254231 TCTAGAAAACAGCCTCAAAAGGG + Intronic
993138461 5:83999644-83999666 TCTAGAAAATAGCCTCAAAGTGG + Intronic
993206913 5:84893964-84893986 TCTAGAAAATATCCTCAAAAGGG - Intergenic
993269057 5:85769806-85769828 TCCAGAAAATAGGCTTAAAAGGG - Intergenic
993519967 5:88888985-88889007 TCTAGAAGAAACAGTTAAAAGGG - Intronic
993580582 5:89655114-89655136 TCTATAAAATAGCCTTGAAAGGG + Intergenic
993582469 5:89679087-89679109 TCTAGAAAATAACATTAAAAGGG + Intergenic
993623487 5:90194522-90194544 TCTAGAAAATAGCCTAAAAAGGG + Intergenic
993932028 5:93952810-93952832 TCTAGAAAAATGCCTCAAAAGGG - Intronic
993981442 5:94547215-94547237 TCTAGAAAATAGCCTGAAAAGGG + Intronic
994028723 5:95115633-95115655 TCTAGAAAATAGCATCAAAAAGG + Intronic
994226386 5:97255715-97255737 TCTAGAAAATAGCCTCAAAATGG + Intergenic
994234050 5:97340893-97340915 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
994265099 5:97705624-97705646 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
994267786 5:97738574-97738596 TCTGTCAAACTGACTTAAAAGGG - Intergenic
994309907 5:98257929-98257951 TCGAGAAAATACCCTTAAAAGGG - Intergenic
994457436 5:100029074-100029096 TGTAGAAAATAGCCTTAAAAAGG + Intergenic
994538558 5:101062956-101062978 TCCAGAAAACAGACTTAAAATGG - Intergenic
994616022 5:102105921-102105943 TCTAGAAAGTAGCCTCAAAAGGG - Intergenic
994621581 5:102170164-102170186 AATAAAAACCAGACTTAAAAAGG + Intergenic
994627962 5:102244389-102244411 TCTAGAAAATAGCCTCAAAACGG + Intronic
994660173 5:102643318-102643340 TATAGAAAATAAACTAAAAAGGG + Intergenic
994889148 5:105606632-105606654 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
994974279 5:106781464-106781486 TCTAGAAAATAGCCTCAAAATGG + Intergenic
995096531 5:108241496-108241518 TCTAGAAAATAGCCTCAAAAGGG + Intronic
995146727 5:108795336-108795358 ACTAGAAAATAGTCTCAAAAGGG - Intronic
995146744 5:108795495-108795517 ACTAGAAAATAGCCTCAAAAGGG - Intronic
995302592 5:110601568-110601590 CCTAGGAATCAAACTTAAAAAGG + Intronic
995441219 5:112194473-112194495 TGGAAAAAACAGACTTACAAAGG + Intronic
995557717 5:113346222-113346244 TCTAGAAAATAGCCTCAAAAGGG + Intronic
995572980 5:113501498-113501520 TATAGAAAATAGCCTCAAAAGGG - Intergenic
995616746 5:113972971-113972993 TCAATAAAACATACCTAAAATGG + Intergenic
995697620 5:114898208-114898230 TCTATAAAAGAGCCTCAAAAGGG - Intergenic
995777814 5:115744579-115744601 TATAGAAAATAATCTTAAAAGGG - Intergenic
995808267 5:116078529-116078551 TCTAGCAAAGAGACGTATAAAGG - Intergenic
995821076 5:116233470-116233492 ACTAGAATACAGACTTCACAAGG - Intronic
996116248 5:119623277-119623299 TCTAGAAAATAGTCTCAAAAGGG - Intronic
996161794 5:120175126-120175148 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
996166270 5:120227759-120227781 TCTAGAAAATATTCTCAAAAGGG - Intergenic
996653487 5:125912138-125912160 TGTAGAAAACAGGCTCAAAAGGG - Intergenic
996712384 5:126555967-126555989 GGTTGTAAACAGACTTAAAAAGG - Exonic
996931499 5:128894904-128894926 TCTAGAAAATAGCCTCAAAAAGG - Intronic
996961361 5:129254238-129254260 TCTAGAAAATAGCCCCAAAAGGG - Intergenic
996968436 5:129332867-129332889 GCTAGAAAATAGCCTCAAAAGGG + Intergenic
996982672 5:129518828-129518850 TCTAGAAAATTGCCTCAAAAGGG - Intronic
997071841 5:130631956-130631978 TCTAGAAAATAGCCTCAAAATGG - Intergenic
997104870 5:131007057-131007079 TCTGGCAAATAGCCTTAAAAAGG + Intergenic
998193891 5:140049665-140049687 TTTAGAAAACAGATCTCAAAAGG - Intergenic
998544771 5:143017546-143017568 TTTAGAAAAAAGAACTAAAAGGG - Intronic
998689227 5:144569201-144569223 TTTAGAAAATAGCCTCAAAAGGG - Intergenic
999126260 5:149248275-149248297 TCTAGAATACAGATTTGGAAAGG + Intronic
999406417 5:151311007-151311029 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
1000134178 5:158328923-158328945 TCTTCAAAAGACACTTAAAAAGG - Intergenic
1000271500 5:159688388-159688410 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1000532347 5:162438996-162439018 ACTAAACAACAGACTTAAAATGG + Intergenic
1000651156 5:163820788-163820810 TCTAGAAAACAGTCTCAAAAGGG - Intergenic
1000752362 5:165112804-165112826 TCTGGAAAACAGTGTCAAAAAGG + Intergenic
1001177829 5:169488264-169488286 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1002890911 6:1330940-1330962 TGTAGAAAAAGGACTTCAAAAGG - Intergenic
1003045705 6:2731050-2731072 TTTAAAAAAAAGATTTAAAAGGG + Intronic
1003056151 6:2822374-2822396 ATTAGAAGACAGACTTAACATGG - Intergenic
1003309250 6:4954451-4954473 TCTAGAACACAGAATCTAAAGGG + Intronic
1003437808 6:6110094-6110116 TCTAGAAAATAGTCTCTAAAGGG - Intergenic
1003496204 6:6665695-6665717 ACTGGAAAACTGACTGAAAAGGG - Intergenic
1003833755 6:10044199-10044221 TCCAAAAATCAGACTTAACATGG + Intronic
1003969107 6:11281192-11281214 GCAAGAAAGAAGACTTAAAAGGG - Intronic
1004795107 6:19073507-19073529 TCTAAAAAATAGTCTCAAAAAGG + Intergenic
1005156906 6:22818007-22818029 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1006018327 6:31101161-31101183 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1006554015 6:34850498-34850520 TCCAGAAAATAGCCTCAAAAGGG - Intronic
1007001433 6:38317634-38317656 TCTAGAAAATAGCCTCAGAAGGG - Intronic
1007022112 6:38530984-38531006 TCTAGAAAACAGCCTCAAAAGGG + Intronic
1007220072 6:40271822-40271844 AGTAGAAAACAGACTGAGAAAGG - Intergenic
1008238302 6:49076413-49076435 TGTAGAAATCCAACTTAAAAGGG - Intergenic
1008239073 6:49085914-49085936 TATAGAAAATAGGCTCAAAAGGG + Intergenic
1008250197 6:49230719-49230741 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1008312374 6:49991544-49991566 TCTAGAAGATAGATTCAAAAGGG + Intergenic
1008641864 6:53472639-53472661 TCTAGAAAATAATCTGAAAAGGG - Intergenic
1008707439 6:54180475-54180497 TTTAGAAAATAGCCTCAAAAGGG - Intronic
1008821098 6:55631249-55631271 TTTAGAAAATAGTCTCAAAAGGG - Intergenic
1008822396 6:55649722-55649744 TCTAGAAAATAGTCTCAGAAGGG - Intergenic
1009329563 6:62400094-62400116 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1009352981 6:62706197-62706219 TCTAGAAAACAGTCTGAAAAGGG - Intergenic
1009371353 6:62906943-62906965 TCTAGAAAAGAGATTCAAAAGGG + Intergenic
1009387957 6:63110137-63110159 CCTAGAAAATAGGCTCAAAATGG - Intergenic
1009510339 6:64543309-64543331 TTTAAAAAACAGTATTAAAATGG + Intronic
1009781840 6:68281252-68281274 TTTAGAAAATAGCCTCAAAAGGG + Intergenic
1009978353 6:70698529-70698551 TCTAGAAAACAGTCCTAAAATGG - Intronic
1010047809 6:71467702-71467724 TCTAGAAGAGAGACAGAAAAAGG - Intergenic
1010306157 6:74325215-74325237 TCTAGAATAAAGATTGAAAAAGG + Intergenic
1010313873 6:74421844-74421866 TCAAGAAAATAGCCTCAAAAGGG + Intergenic
1010416559 6:75618112-75618134 TCAAAAACACAGACATAAAAGGG - Intronic
1010483406 6:76381236-76381258 TCTAGGAAATAGACTCAAAAGGG - Intergenic
1010560131 6:77339368-77339390 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
1010626444 6:78141098-78141120 TCTAGAAAATAGCCCGAAAAGGG + Intergenic
1010676815 6:78755003-78755025 TCTAGAAAACAACCCCAAAAGGG + Intergenic
1010772652 6:79849114-79849136 TCTAGAACATAGCCTCAAAAAGG + Intergenic
1010775511 6:79880284-79880306 TCTAGAAAATAGACTCAAAGGGG + Intergenic
1010803275 6:80202894-80202916 TCTAGAAAACAGATGGAAAGAGG - Intronic
1010843056 6:80671448-80671470 TCTAGAAAGTAGAAGTAAAAAGG + Intergenic
1011024100 6:82846944-82846966 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
1011033371 6:82946007-82946029 TCTAGAAAATAGCCTTCAAGGGG + Intronic
1011102755 6:83742784-83742806 TCTAGAAAATAACCTTAAAAGGG - Intergenic
1011177041 6:84575225-84575247 ACTAGAAAACAGAATTAAGCGGG - Intergenic
1011237601 6:85234582-85234604 TCTAGAAAACAGCCTTAAAAAGG + Intergenic
1011625428 6:89279465-89279487 TCTGGGAAACAGACTTTCAAAGG + Intronic
1011901506 6:92303566-92303588 TCTAAGAAACAGCCTGAAAATGG + Intergenic
1011935686 6:92774332-92774354 TCTTGAAAATAGATCTAAAAAGG + Intergenic
1011978363 6:93336979-93337001 GTTAGAAAAAAGACATAAAAAGG + Intronic
1012003771 6:93686436-93686458 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1012056971 6:94425671-94425693 TCTAGAAAACAGCTTTAAAAAGG - Intergenic
1012091617 6:94904287-94904309 TCTAGAAAATAGCCTCAAAATGG + Intergenic
1012224666 6:96690150-96690172 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
1012288237 6:97420389-97420411 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1012293951 6:97495994-97496016 TGTAGAAAATAGTCTCAAAAGGG + Intergenic
1012512391 6:100018131-100018153 ACTAGAAAATAGCCTCAAAAGGG + Intergenic
1012620402 6:101338069-101338091 TCGAGAAAACAGGCTCAAGAGGG - Intergenic
1012679104 6:102155495-102155517 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1012714582 6:102652004-102652026 TCTAGAAAATAGACTCAAAAGGG + Intergenic
1012715462 6:102662587-102662609 TCTAGAAAATAACCTCAAAAGGG + Intergenic
1012717626 6:102697568-102697590 TCTAGAAAAGAGCCTCAAAAGGG - Intergenic
1012827509 6:104164337-104164359 TCTAGAAAATACAATAAAAAGGG + Intergenic
1012890670 6:104893651-104893673 TCTTAAAAAAAAACTTAAAATGG - Intergenic
1012892279 6:104909730-104909752 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
1012893529 6:104923602-104923624 TCTAGAAGACAGTTTTAAATTGG - Intergenic
1012930608 6:105312353-105312375 TCTTAAAGACAGAATTAAAATGG + Intronic
1013648264 6:112167419-112167441 TTTAGAAAACAAACTTAAGTGGG - Intronic
1013695843 6:112701630-112701652 TATAGAATACAGAGTTAGAAGGG + Intergenic
1013885024 6:114952881-114952903 TAGAGAAAACAAACCTAAAAGGG - Intergenic
1014073754 6:117214003-117214025 TCTAGAAAATAGCTTCAAAAGGG - Intergenic
1014147769 6:118017721-118017743 CTTAGAAAACAAAATTAAAAGGG - Intronic
1014542255 6:122691326-122691348 TCTAGAAAATACCCTCAAAAAGG - Intronic
1014845790 6:126275309-126275331 TCTGTAAAATAGGCTTAAAATGG + Intergenic
1014855392 6:126395170-126395192 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1014862436 6:126486028-126486050 TCTAGAAAACAGCCTGTAAAAGG + Intergenic
1014865084 6:126519899-126519921 TCTGGAAAATAGACTCAAAAGGG - Intergenic
1014928561 6:127304909-127304931 TATAGAAAATAGTCTCAAAAGGG + Intronic
1014988566 6:128044915-128044937 TCTAGATGACAGCATTAAAATGG - Intronic
1015052688 6:128862055-128862077 TCTAGAAAATAGCCTCATAATGG - Intergenic
1015460889 6:133489255-133489277 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1015931264 6:138362343-138362365 TCTAAAAATCAGTCCTAAAAAGG + Intergenic
1016028761 6:139315850-139315872 TTTAATCAACAGACTTAAAATGG + Intergenic
1016061414 6:139635058-139635080 TCTAGAAAATATCCTCAAAACGG - Intergenic
1016151758 6:140749532-140749554 TTCAGAAAATAGCCTTAAAAGGG + Intergenic
1016185576 6:141194527-141194549 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1016229967 6:141790617-141790639 TCTAAAAAATATACTTAAAAGGG + Intergenic
1016254459 6:142088064-142088086 TAGAGTAAACAGAGTTAAAACGG - Intronic
1016449218 6:144164004-144164026 TCTAGAAAATATACTTTAAAAGG + Intronic
1016457208 6:144243859-144243881 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1016538365 6:145134842-145134864 TCTAGAACATAGCCTCAAAAGGG - Intergenic
1016542444 6:145180738-145180760 TCTAGAAATAAAACTTACAAGGG + Intergenic
1016543161 6:145189741-145189763 TTTTAAAAGCAGACTTAAAAGGG - Intergenic
1016608858 6:145964968-145964990 CCTCAAAAACAGACTTTAAAGGG + Intergenic
1016615285 6:146040887-146040909 TCCAGAAAATAGCCTCAAAAAGG - Intronic
1017306059 6:152919795-152919817 TCATGAAAACAAACTGAAAAGGG - Intergenic
1017318772 6:153063586-153063608 TCTAGAAAATAGACTCAACAGGG + Intronic
1017398024 6:154026580-154026602 TCTAGCAAACAGCCCTCAAATGG - Intronic
1017491431 6:154948969-154948991 TCTAGAAAATAGCCTCAAATGGG - Intronic
1017924597 6:158900090-158900112 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1018044732 6:159955872-159955894 TCCAGAAAAGAAACATAAAAAGG + Intergenic
1018298466 6:162375441-162375463 TCTACAAAAGAGCCTTAACATGG + Intronic
1018316765 6:162564024-162564046 TCTATAAAATAGCCTTAAAAGGG + Intronic
1018591535 6:165430038-165430060 TTTAGAAAACATACATCAAATGG + Intronic
1018632329 6:165831828-165831850 CCAAGAAAACAGTATTAAAAAGG - Intronic
1019933625 7:4240202-4240224 TCTGGAAAACAGACTTGAAAAGG + Intronic
1020485214 7:8713054-8713076 TCTAGAAAATAGCCACAAAATGG - Intronic
1020515169 7:9108394-9108416 TCTAGAAAATAGCCTCAAAGAGG + Intergenic
1020519825 7:9172005-9172027 CCTAGAAAATAGCCTCAAAAGGG - Intergenic
1020537044 7:9412898-9412920 TTTAGAAATCAGACTGAAGAAGG - Intergenic
1020573175 7:9891706-9891728 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1020607242 7:10355028-10355050 TCTAGAAAAGAGCCTCAAAAGGG - Intergenic
1020624393 7:10559475-10559497 TCTAGATAATAGCCTCAAAAAGG + Intergenic
1021034970 7:15786299-15786321 TCTAGAAAATAGCCTCCAAAGGG + Intergenic
1021040371 7:15854946-15854968 TCTTGAAAACATTCTTACAATGG - Intergenic
1021211950 7:17864507-17864529 TCTAGAAAACAGTGTCATAAGGG + Intronic
1021214422 7:17899452-17899474 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1021589130 7:22241853-22241875 GCAAGACAACAGACTTGAAATGG + Intronic
1021641155 7:22737217-22737239 TCTAGAAAACAGCCTCAAATGGG + Intergenic
1022348416 7:29540561-29540583 TCTAGAAAATAGCCTCACAAGGG + Intergenic
1022395342 7:29983218-29983240 TCTAGTAAACTGACATAAAATGG - Intronic
1022541851 7:31144974-31144996 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1022758762 7:33325118-33325140 TCTAGAAAATAGCCTCAAAAAGG - Intronic
1023241089 7:38148062-38148084 TCTAAAAAATAGCCTGAAAAGGG + Intergenic
1023632894 7:42181168-42181190 TCTAGAAAACAGACTTTCTAGGG + Intronic
1024170441 7:46779489-46779511 TCTAGTAAATAGCCTCAAAAGGG + Intergenic
1024418882 7:49139296-49139318 TTTAGAAAACCGAATAAAAAGGG + Intergenic
1024445486 7:49473442-49473464 TCTGGAGAACTGACTGAAAATGG + Intergenic
1024488360 7:49946840-49946862 TCTAGAAAATAGCCTCTAAAGGG - Intronic
1024662257 7:51509638-51509660 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1024956686 7:54928086-54928108 TCTAGAAAATGGCCTCAAAAGGG + Intergenic
1025138142 7:56437981-56438003 TCTAGAAAGCAGCCTCAAAAGGG + Intergenic
1026040852 7:66866535-66866557 TTTTGAAAAGTGACTTAAAATGG - Intergenic
1027405175 7:77853211-77853233 TCTAGAAAATACCCTCAAAAAGG - Intronic
1027480982 7:78696103-78696125 TCTACAAAACAAAAATAAAAAGG - Intronic
1027605062 7:80289461-80289483 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1027717994 7:81698229-81698251 TCTAGAAAAGAGAGAAAAAAAGG + Intergenic
1027826262 7:83120030-83120052 TCTAGAAAACAGTCTCAACAGGG + Intronic
1027921470 7:84400628-84400650 TCTAGAAAATAGCCTCAAAGGGG + Intronic
1027996266 7:85428555-85428577 TCTAGAAAATAGCCTCAACAGGG + Intergenic
1028126892 7:87123282-87123304 TCTGTAAAACAGACTTACTAAGG + Intergenic
1028161205 7:87486624-87486646 TCTAGAAAATAGCATCAAAAGGG + Intergenic
1028169606 7:87580695-87580717 CCTACAAAATAGCCTTAAAAGGG - Intronic
1028175086 7:87646806-87646828 AAGAGAAAACAGATTTAAAAGGG - Intronic
1028207017 7:88030113-88030135 TCTAGAAAACAACCTCAAAGGGG - Intronic
1028324548 7:89506018-89506040 TCTAGGAATCGAACTTAAAAGGG + Intergenic
1028339198 7:89696575-89696597 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1028353416 7:89878045-89878067 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1028428319 7:90716318-90716340 TCTAGAAAAGAAATTTGAAAAGG - Intronic
1028645508 7:93092356-93092378 TCTAGAAAATAACCTTAAAAGGG - Intergenic
1028779673 7:94722239-94722261 TTTAGAAAATAGTCTCAAAAGGG + Intergenic
1028872982 7:95788950-95788972 TCTGGAAGAAAGAATTAAAATGG - Intronic
1028929319 7:96395939-96395961 TCTGGAAAACAGCCTCAAAGGGG - Intergenic
1030390717 7:108924724-108924746 TCTAGAAAATAGCCTCAAAATGG - Intergenic
1030476608 7:110042421-110042443 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1030599184 7:111573127-111573149 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
1030723680 7:112899432-112899454 TCTGGAAAATAGCCTCAAAAGGG + Intronic
1031098661 7:117450377-117450399 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1031216751 7:118902499-118902521 TTTAGAAAACAAACATAAAATGG - Intergenic
1031231459 7:119113131-119113153 TCTAGAAAATAGTCTCAAAAAGG - Intergenic
1031611958 7:123838480-123838502 TATACAAAACACATTTAAAATGG - Intronic
1031673773 7:124584515-124584537 TCTAGAAAAAAGATTTATTATGG - Intergenic
1031834871 7:126670275-126670297 TCTAGAAAAGAGAGGTAAAAAGG + Intronic
1031862450 7:126995714-126995736 TCTAGAAAATAGCTTCAAAAGGG + Intronic
1032029536 7:128471122-128471144 TCTAGAACAGTGATTTAAAAAGG - Intergenic
1032138617 7:129306229-129306251 TCTAGAACATAGCCTCAAAAGGG - Intronic
1032803789 7:135336930-135336952 TGTAGAGAACAGACTAGAAAGGG + Intergenic
1032811286 7:135420706-135420728 TCTATTAAATAGAGTTAAAAAGG - Intronic
1033279721 7:139997023-139997045 TCAAGATAACATACTGAAAATGG - Intronic
1033284366 7:140027686-140027708 TCTTGGAAACTGACTTAAAGTGG - Intronic
1033489057 7:141823759-141823781 TCTAGAAAATAGCCTTAAAGGGG - Intergenic
1033490288 7:141836752-141836774 TCTAGAAATCACATGTAAAATGG + Intronic
1033500072 7:141938484-141938506 TCTAAAAAATAGCCTCAAAAGGG + Intronic
1033541815 7:142364295-142364317 TCTAGAATATAGCCTCAAAAGGG - Intergenic
1033867619 7:145712280-145712302 TCCAGAAAATAGCCTCAAAAGGG - Intergenic
1034003263 7:147441107-147441129 TCTAGAAAGTAGCCTCAAAAGGG - Intronic
1034096903 7:148417508-148417530 TCTATAAAATACATTTAAAATGG + Exonic
1034218586 7:149427034-149427056 TGTAGAAAACAGAAATAAAAGGG + Intergenic
1034398243 7:150843863-150843885 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1034581617 7:152048768-152048790 TCTAGAAAACAGCCTCAAAAAGG - Intronic
1034861880 7:154602839-154602861 TCTATAAAAAAGAATTAAGATGG - Intronic
1035110909 7:156480997-156481019 TCCAGAGAACAGGTTTAAAAGGG - Intergenic
1035550978 8:524810-524832 TCTAGAAAATAGCCTCAAAAAGG + Intronic
1036211734 8:6846802-6846824 TCTAGGAATCCAACTTAAAAGGG - Intergenic
1037037347 8:14183357-14183379 TCTTGAGAACAGAATAAAAATGG + Intronic
1037334416 8:17778511-17778533 TCAATAAACCAGACTTAAAGAGG + Intronic
1037575921 8:20202699-20202721 TGTAGAAATCAGACCTATAAAGG + Intronic
1037648900 8:20818947-20818969 AAAAGAAAACAGACTTAAAGCGG - Intergenic
1038871738 8:31502683-31502705 TCTAGAAAATAGACTCAAAATGG - Intergenic
1039227914 8:35409880-35409902 TATACAAAACTGACTCAAAATGG - Intronic
1039281727 8:35993333-35993355 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1039291040 8:36094810-36094832 TCTATAAAACAAACTCATAATGG - Intergenic
1040485917 8:47871083-47871105 TCTAGAAAAGAGCCTCAAAAGGG + Intronic
1040742943 8:50603156-50603178 TCAAGAAAATAGCCTTGAAAAGG - Intronic
1041050310 8:53927681-53927703 TCTGCCAAACAGACTAAAAAAGG + Intronic
1041115242 8:54529521-54529543 AGTAGAAAACAGATTTAAAAAGG - Intergenic
1041189479 8:55338993-55339015 TCTAGAAACCAGAACTATAAAGG + Intronic
1041305095 8:56449361-56449383 TCTAGAAATCAGACTAAAAAAGG + Intergenic
1041670860 8:60490414-60490436 TCCTGAAAACATACTTAAAAAGG - Intergenic
1041769736 8:61459696-61459718 TATGGAAAACAGAATTACAAGGG - Intronic
1041841172 8:62273406-62273428 AATAGAAAAAAGCCTTAAAAAGG + Intronic
1041869104 8:62613659-62613681 TCTAGAAAATGGCCTCAAAAGGG - Intronic
1041921883 8:63191464-63191486 TTAAGAAAACAGAGTTAAGAGGG - Intronic
1042082380 8:65069728-65069750 TCGAGAAAATAGCCTCAAAAAGG - Intergenic
1042162832 8:65914112-65914134 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1042297093 8:67232364-67232386 TTTAGAAAACAAACTAAAAATGG + Intronic
1042298206 8:67244726-67244748 TCTGGAAAATAGTTTTAAAAGGG + Intronic
1042428354 8:68674647-68674669 TCTAGAAAATAGGTCTAAAATGG + Intronic
1042451625 8:68954375-68954397 TCTAGGAAACAGCATAAAAATGG + Intergenic
1042726704 8:71887067-71887089 TCTAGAAAACAGCCTCAAAAGGG - Intronic
1042898545 8:73696735-73696757 TCTAGAAAATAGCCTCAAAGGGG + Intronic
1042981187 8:74530761-74530783 TCTCCAAAAAAGACTTACAAAGG + Intergenic
1043015800 8:74939375-74939397 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1043042235 8:75277407-75277429 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1043227206 8:77747439-77747461 TATAGAAAATAGTCTAAAAATGG + Intergenic
1043314181 8:78899348-78899370 TCTTGAAAACACTCTTAAAAAGG + Intergenic
1043323162 8:79016473-79016495 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
1043340113 8:79228237-79228259 TCTAGAAAATAGCCTCAATAGGG - Intergenic
1043343027 8:79264857-79264879 CATCGAAAACAAACTTAAAAAGG + Intergenic
1043554154 8:81410508-81410530 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1043600386 8:81929818-81929840 TCTAGAAAATAGCCTCTAAAAGG + Intergenic
1043627150 8:82275224-82275246 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1043629401 8:82309679-82309701 CCTAGAAAACGGATTCAAAAGGG + Intergenic
1043760402 8:84061611-84061633 TCTAGAAAATAGCCTCGAAAGGG - Intergenic
1044066396 8:87705009-87705031 TCTAGAACATAGCCTCAAAATGG + Intergenic
1044071808 8:87770168-87770190 TTTTGAAAACACACTTAAAACGG - Intergenic
1044499472 8:92935620-92935642 TTTAAAAAACAGAGTCAAAAGGG + Intronic
1044544339 8:93442959-93442981 TGTAGTAAACACACTTAAGAAGG - Intergenic
1044635311 8:94318369-94318391 TTTAGAAAATAGCCTCAAAAGGG - Intergenic
1044636652 8:94331927-94331949 TCTAGAAACCAGCTTTAATAGGG - Intergenic
1045304165 8:100943109-100943131 TCTAGAAAACATGCTAAAATTGG + Intronic
1045592278 8:103611918-103611940 TCTAGAAAATAGACTGAAAAGGG - Intronic
1045598860 8:103691324-103691346 TCTAGAAAATAGCCTCAAAATGG - Intronic
1045648633 8:104323167-104323189 TCTATAAAACAGACTAATAATGG + Intergenic
1045733217 8:105265721-105265743 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1045862668 8:106830685-106830707 TCAAGTAAATTGACTTAAAAAGG - Intergenic
1046041202 8:108907069-108907091 TCTAGAAAATAGAGGTAAAGGGG + Intergenic
1046215417 8:111139878-111139900 TCTAGAAAATAGCCTTAAAATGG - Intergenic
1046244759 8:111544666-111544688 TATGGTAAACAGGCTTAAAAAGG - Intergenic
1046389313 8:113547680-113547702 AATAGAAAACAGTATTAAAAAGG - Intergenic
1046441823 8:114265912-114265934 TCTACAAAATACACATAAAAAGG - Intergenic
1047352245 8:124087222-124087244 TCTAGAAAACAGCCTCCAAGAGG - Intronic
1047443711 8:124901224-124901246 TGTAGAAAAAGGACTTCAAAAGG - Intergenic
1047780593 8:128107615-128107637 GCGATAAAAAAGACTTAAAAGGG - Intergenic
1047901274 8:129424593-129424615 TTTAGAAAATAGCCTCAAAAAGG + Intergenic
1047936079 8:129780119-129780141 TGTAGAAAATAGCCTCAAAAGGG + Intronic
1048593444 8:135842865-135842887 TCAAGGAAACAGGCTTAGAAAGG + Intergenic
1048946479 8:139453133-139453155 TCCAGCAAAGAGACTTATAATGG + Intergenic
1049904489 9:203303-203325 TCTGGAAAACAGTCTTCCAAAGG + Intergenic
1050121772 9:2315552-2315574 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
1050187073 9:2985826-2985848 TCTAGGAAACAGACTCAACGTGG - Intergenic
1050225237 9:3446794-3446816 TCTCTCACACAGACTTAAAATGG + Intronic
1050238669 9:3611601-3611623 TCTAGAAAATAGCCCCAAAAGGG - Intergenic
1050392359 9:5158198-5158220 TCTAGAAAATAGCCCAAAAAGGG + Intronic
1050509828 9:6382728-6382750 TCCAGAAAAGAGACATAAAAAGG - Intergenic
1050618447 9:7427986-7428008 TTTAGAAAATAGCCTCAAAAGGG - Intergenic
1050644086 9:7700873-7700895 TCTAGAAACTAGCCTCAAAAGGG - Intergenic
1050807006 9:9693733-9693755 TCTAGAAAATATCCTCAAAAGGG - Intronic
1050964433 9:11780506-11780528 ATTAGAAAACAGGCTCAAAATGG - Intergenic
1050997164 9:12234894-12234916 TCTTGCAAACACAATTAAAAGGG + Intergenic
1051306887 9:15719334-15719356 TTTAGAAAATAGTCTCAAAAGGG + Intronic
1051645990 9:19269071-19269093 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1051805461 9:20987822-20987844 TTTAAAAAACAAAATTAAAAGGG + Intronic
1052063484 9:23988510-23988532 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1052065243 9:24010374-24010396 TTTAGAAAACTGAGCTAAAACGG + Intergenic
1052258591 9:26489168-26489190 TGTAGAAAATAGCCTCAAAAGGG - Intergenic
1052607611 9:30724489-30724511 TCTTGAAAACAATCTTAAAAGGG + Intergenic
1053028180 9:34749211-34749233 TCTAGAAAATACCCTCAAAAGGG + Intergenic
1053110383 9:35454766-35454788 TCTAGAAAATAACCTTAAAAGGG + Intergenic
1053204835 9:36177126-36177148 TCTAGAAAATTGCCTCAAAAGGG + Intergenic
1054836815 9:69684011-69684033 TCAAGAAAACAGAATTTAAATGG + Intergenic
1054956407 9:70915735-70915757 TCTAGAAAATATCCTCAAAAAGG + Intronic
1055227523 9:74016740-74016762 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1055302249 9:74893837-74893859 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1055370815 9:75596978-75597000 TCTCAAAACCAGCCTTAAAAGGG + Intergenic
1055827177 9:80340660-80340682 TCTAGAAAATACCCTCAAAAGGG + Intergenic
1055886312 9:81068118-81068140 TCTAGAAAATAGCATTAAAAGGG - Intergenic
1055910091 9:81340392-81340414 TCCAGAAAATAGATTTTAAAAGG + Intergenic
1055910981 9:81350887-81350909 TATAGAAAATAGGCTCAAAAGGG + Intergenic
1056087997 9:83173380-83173402 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1056230400 9:84537555-84537577 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1056457004 9:86770136-86770158 TCAACAAAACAGACATAGAAGGG + Intergenic
1056533647 9:87509178-87509200 TGTAGAGAACAGACTTTTAATGG + Intronic
1056957525 9:91094218-91094240 TCCAGAAAACAGCCTGAAAAGGG + Intergenic
1057074631 9:92131534-92131556 TCTAGAAAATAAACTCAAAAGGG - Intergenic
1057084669 9:92198070-92198092 TCTAGAAAATAATCTCAAAAGGG + Intergenic
1058004122 9:99897158-99897180 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1058241758 9:102570790-102570812 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1058285057 9:103167593-103167615 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1058821097 9:108730132-108730154 TCTAGAAAATAGCTCTAAAAAGG + Intergenic
1059900423 9:118919831-118919853 TCTAGAAAATAGCCTTAAAGGGG - Intergenic
1060166523 9:121421660-121421682 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
1061643621 9:131980666-131980688 TCTTGAAAACTGTTTTAAAACGG + Intronic
1185861004 X:3579304-3579326 AGTAGAAAAGAGACATAAAATGG + Intergenic
1186054237 X:5632043-5632065 TGTAGAAAACAGACTACGAAGGG - Intergenic
1186085727 X:5988601-5988623 TCCACTAAACAGACTTTAAAAGG + Intronic
1186117511 X:6320650-6320672 TCTAGAAAACAGACTCATTATGG - Intergenic
1186691436 X:11980417-11980439 TATAGAAAACAAACCAAAAATGG - Intergenic
1187133012 X:16520146-16520168 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1187206177 X:17183858-17183880 TCTTGAAAACACACCTAACAGGG + Intergenic
1187315051 X:18185151-18185173 TCTAGAAAACAGCCTCAAAATGG + Intronic
1187348417 X:18489113-18489135 CAAAAAAAACAGACTTAAAAAGG - Intronic
1187395816 X:18918243-18918265 TCGAAAAAACAGAGTAAAAATGG + Intronic
1187613038 X:20962757-20962779 TCTAGCAAATAGTCTCAAAAGGG + Intergenic
1187836845 X:23439726-23439748 TCAAGAAAATAGTCTTGAAAGGG + Intergenic
1187889318 X:23919212-23919234 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1188192117 X:27183879-27183901 TCTAGAAAACAGCCTAAAAAGGG + Intergenic
1188210792 X:27420801-27420823 TCTAGAAAATAGTCTCAAACAGG + Intergenic
1188530432 X:31134233-31134255 TATAGAAAACAGATATTAAAGGG + Intronic
1188540074 X:31239716-31239738 TCTAGAAACCACTCTTAACAGGG - Intronic
1188579092 X:31688025-31688047 TCCAGAAAATAGCCTCAAAAGGG - Intronic
1188742822 X:33807672-33807694 TCTAGAAAATAGCATTGAAATGG - Intergenic
1188862629 X:35275007-35275029 TCCAGAAAACAGAGGTAAACAGG - Intergenic
1188864788 X:35301425-35301447 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1188998926 X:36922133-36922155 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1189061653 X:37759850-37759872 TCTAGTAGACCGAATTAAAATGG + Intronic
1189524461 X:41805053-41805075 ACTAAAAAACACAATTAAAATGG + Intronic
1189628361 X:42922971-42922993 TCTAGAAAATAGACTTGAAAGGG + Intergenic
1189640968 X:43069610-43069632 TCTAGAAAATAGACTCAAAAGGG + Intergenic
1189855605 X:45222006-45222028 TCTAGAAAATAGCCTCCAAAGGG - Intergenic
1189875499 X:45432383-45432405 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1189881330 X:45496688-45496710 CCTAGAAAATAGCCTCAAAAGGG - Intergenic
1189885037 X:45533991-45534013 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1190015300 X:46821311-46821333 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1190367948 X:49715194-49715216 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1190441857 X:50482650-50482672 GCTAGAAAATAGACATACAAGGG - Intergenic
1190530553 X:51370158-51370180 TCTAGAAAATAGCATCAAAAGGG + Intergenic
1190893708 X:54595675-54595697 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1190899164 X:54652116-54652138 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1191043708 X:56113583-56113605 TCTAGACAAAAAAATTAAAAAGG + Intergenic
1191048996 X:56170689-56170711 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
1191059174 X:56276889-56276911 TCTAGAAAATAGCCTCAAAAAGG - Intronic
1191116593 X:56859179-56859201 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1191149105 X:57201784-57201806 TCTTGAAAATAGCCTCAAAAGGG - Intergenic
1191179314 X:57542271-57542293 TCTACAAAATAGCCTCAAAAGGG + Intergenic
1191599970 X:62992611-62992633 TCTAGAAAACACTCTCAAAACGG - Intergenic
1191650428 X:63530957-63530979 TCCAGAATACAGCCTCAAAAGGG + Intergenic
1191770677 X:64754945-64754967 TCTAGAAACTAGCCTCAAAAAGG - Intergenic
1191774972 X:64803690-64803712 TCCAGAAAACAGCCTCAAAAGGG + Intergenic
1191812010 X:65199119-65199141 TCTAGAAAATAGCCTTTTAAGGG - Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1191950012 X:66580433-66580455 TCTAGAAAATAGTCTCAAAAGGG - Intergenic
1191973994 X:66850120-66850142 TCTGGAAAATAGACCCAAAATGG - Intergenic
1192045842 X:67673421-67673443 TCTAGAAAACAGCCTCAAAAGGG - Intronic
1192063405 X:67854803-67854825 AATTGAAAACAGACTTACAATGG - Intergenic
1192073336 X:67963757-67963779 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1192088198 X:68122848-68122870 TCTATAAAATAGTCTCAAAAGGG + Intronic
1192304250 X:69942833-69942855 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1192393573 X:70755524-70755546 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1192400394 X:70828590-70828612 TCTAGAAAATAGCCTCAAAAGGG + Intronic
1192417649 X:70997770-70997792 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1192423606 X:71055770-71055792 TTCAGAAAACAGGCCTAAAATGG + Intergenic
1192605627 X:72514014-72514036 TTTGGTAAACACACTTAAAATGG + Intronic
1192695295 X:73407547-73407569 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
1192714615 X:73626436-73626458 TCTAGAAAATAGTATCAAAAAGG - Intronic
1192839024 X:74834945-74834967 TCTAGAAAACAGCCTCAACAGGG - Intronic
1192841338 X:74859015-74859037 TCTAGAAAATAGTCTCAAAAGGG + Intronic
1192853571 X:74983227-74983249 TCTAGAAAATAGCCTTGAAGGGG + Intergenic
1192858332 X:75038546-75038568 CCTAGAAAATAGCCTCAAAAGGG - Intergenic
1192875074 X:75221463-75221485 TCTAGAAAATAGCCTCAAAGGGG - Intergenic
1192891092 X:75391220-75391242 TCTAGAAAATAGCCTAAAACTGG + Intronic
1192927291 X:75768536-75768558 TCTAGAGAATAACCTTAAAAGGG + Intergenic
1192940559 X:75907845-75907867 TCTAGAAAATTGCCTCAAAAGGG - Intergenic
1193003946 X:76595287-76595309 TATATAAAATAGACTCAAAAAGG - Intergenic
1193092742 X:77511821-77511843 TCTAGAAAATAGCCTCAAATGGG + Intronic
1193147326 X:78091217-78091239 TATAGAAAATAGCCTCAAAAGGG - Intronic
1193167576 X:78299933-78299955 TCTAAAAAATAGCCTCAAAAGGG - Intronic
1193172821 X:78356719-78356741 CCTAGAAAATAGCCTCAAAAGGG - Intergenic
1193260956 X:79405515-79405537 TCTAGAAAATAGACTCAAAAGGG + Intergenic
1193300195 X:79880403-79880425 TCTAGAAAATAGCCTCCAAAGGG + Intergenic
1193305935 X:79951083-79951105 TCTAGAAAATAGCCTCATAAGGG + Intergenic
1193366055 X:80635749-80635771 TCTAAAAAATAGCCTCAAAAAGG - Intergenic
1193409188 X:81142211-81142233 TCTAGAAAACAGCCCCAAAAGGG + Intronic
1193448531 X:81637323-81637345 TCTAGAAAGTAGCCTTAAAAGGG + Intergenic
1193455466 X:81726206-81726228 TCTAGAAAATAGTCTCAAAAGGG + Intergenic
1193504825 X:82329330-82329352 TCTAGGAAATAGCCTCAAAAGGG - Intergenic
1193524342 X:82571354-82571376 TCTAGAAAATGGCCTCAAAATGG - Intergenic
1193561614 X:83024054-83024076 TCTAGAAAACGGCCTCAAAAGGG + Intergenic
1193585221 X:83312802-83312824 TCCAGAAAATAGCCTCAAAAGGG + Intergenic
1193596272 X:83450215-83450237 ACTAGAAAATAGCCTCAAAAGGG - Intergenic
1193631658 X:83896757-83896779 TCTAGAAAATATCCTCAAAAGGG - Intergenic
1193670445 X:84377752-84377774 TCTAGAAAATAGACTCAAAAGGG + Intronic
1193683587 X:84551608-84551630 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1193693039 X:84670215-84670237 TCTAGAAAATAGGCTCAAAAGGG + Intergenic
1193815884 X:86104061-86104083 TCTAGAAAATGGCCTCAAAAAGG + Intergenic
1193821339 X:86169530-86169552 TCTAGAAAACAGCATTAAAAGGG - Intronic
1193856400 X:86609113-86609135 TCTATAAAATAGCCTCAAAAGGG - Intronic
1193877701 X:86882646-86882668 TCTAGAAAATATCCTCAAAAAGG - Intergenic
1193894965 X:87101830-87101852 TCTAGAAAATTGCCATAAAAGGG + Intergenic
1193930751 X:87547865-87547887 TTTAGAAAATAAATTTAAAAGGG + Intronic
1193981781 X:88189354-88189376 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
1193986664 X:88251286-88251308 TCTAGGAAATAGCCTCAAAAGGG - Intergenic
1194006853 X:88505367-88505389 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
1194033316 X:88841802-88841824 TCTAGAAAATAGTCTCAAAAAGG + Intergenic
1194096030 X:89639590-89639612 TCTAGAAAATTGCCTGAAAATGG + Intergenic
1194106643 X:89777937-89777959 CCTACAAAACAGACCAAAAAGGG + Intergenic
1194165216 X:90507218-90507240 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1194204267 X:90993634-90993656 CCTAGAAAACAAAACTAAAATGG + Intergenic
1194218637 X:91165154-91165176 TCTAGAAAACAACCTCAAAAGGG - Intergenic
1194229411 X:91302995-91303017 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
1194236074 X:91384423-91384445 TCTAGAAAACAGCCTCAAAAAGG + Intergenic
1194253343 X:91604586-91604608 TCTAGCAAATAGCCTCAAAAGGG + Intergenic
1194257359 X:91651375-91651397 TCTAGAAAATAGCCTCAAAACGG - Intergenic
1194290927 X:92071127-92071149 TCTAGGAAATAGCCTAAAAAGGG - Intronic
1194338553 X:92680903-92680925 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1194348432 X:92794977-92794999 TCTAGAAAATACCCTCAAAAGGG + Intergenic
1194352380 X:92836238-92836260 TCTAGAAAATAGCCTCAAATGGG + Intergenic
1194387942 X:93279692-93279714 TCTAGAAAATAACCTCAAAAGGG + Intergenic
1194389315 X:93296186-93296208 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1194431622 X:93814337-93814359 TCTAGAAAATAGCCTCAAATGGG + Intergenic
1194457384 X:94122108-94122130 TCTAGAAAACAACCTCAAAAGGG - Intergenic
1194495445 X:94611942-94611964 TCTAGAAAACAACCGCAAAATGG - Intergenic
1194506634 X:94741876-94741898 TCTAGAAAATAGCCTCAAAACGG - Intergenic
1194586248 X:95737584-95737606 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1194738962 X:97549447-97549469 TCTAGAAAAAAGATTAATAAAGG - Intronic
1194787455 X:98104921-98104943 TCTAGAAAATAGCCTCTAAAGGG - Intergenic
1194796048 X:98212070-98212092 TCAAGAAAATAGTCTCAAAAGGG + Intergenic
1194861522 X:99004456-99004478 TTGATAACACAGACTTAAAATGG - Intergenic
1194889977 X:99366070-99366092 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
1194921821 X:99776943-99776965 TATAGAAAACAGCCTCCAAATGG - Intergenic
1194990930 X:100545655-100545677 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1195116004 X:101698307-101698329 TCTGGAAAATAGCCTCAAAAGGG + Intergenic
1195122776 X:101773685-101773707 TCTAGAAAATATACTCAAAAGGG - Intergenic
1195132278 X:101864933-101864955 TCTATAAAACAGCCACAAAAGGG + Intergenic
1195136373 X:101910778-101910800 ACTAGAAAATAGATTGAAAAAGG + Intronic
1195199515 X:102534160-102534182 TCTAGAAAATAGCTTCAAAAGGG + Intergenic
1195199895 X:102538597-102538619 TCTAGAAAATAGCATGAAAAGGG - Intergenic
1195396311 X:104413789-104413811 TCTAGAAAATAGTTTCAAAAGGG + Intergenic
1195559269 X:106264913-106264935 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1195824885 X:108989052-108989074 CCTAGAAAACAGTCTCAAAAGGG - Intergenic
1195834723 X:109101576-109101598 TCCAGATAACAGCCTCAAAAGGG - Intergenic
1195848982 X:109262952-109262974 TCTAGAAAATAGCCTGAAAAGGG - Intergenic
1195928551 X:110050482-110050504 TCTATAAAGCAGACATCAAAGGG - Intronic
1196096561 X:111807212-111807234 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1196215468 X:113046588-113046610 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1196232309 X:113238508-113238530 TCTAGAAAATAGCCTCAAGATGG - Intergenic
1196233331 X:113251466-113251488 TCTGGAAAATAGCCTAAAAAGGG - Intergenic
1196248597 X:113430126-113430148 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1196304822 X:114088507-114088529 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
1196331421 X:114474402-114474424 TGTAGAAATCATACATAAAAAGG + Intergenic
1196351365 X:114734821-114734843 TCTAGTATACAGTTTTAAAAAGG + Intronic
1196368903 X:114953460-114953482 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1196399376 X:115298437-115298459 TCTAGAAAATAGCCTCAAAAGGG - Intronic
1196479786 X:116134663-116134685 TCTATGAAACAGCCTCAAAAAGG - Intergenic
1196494207 X:116305617-116305639 TCTAGAAAATAACCTCAAAAGGG - Intergenic
1196511941 X:116522343-116522365 TCTGGAAAATAGCCTCAAAATGG - Intergenic
1196564693 X:117190948-117190970 TCTAGAAAATAGCCTCAAAAAGG + Intergenic
1196576438 X:117324391-117324413 TCTAGAAAATAGCTTCAAAAGGG - Intergenic
1196613933 X:117745236-117745258 TCTAGAAAATAGTGTCAAAATGG + Intergenic
1196639410 X:118040557-118040579 TCTAGAAAATAGTCTCAAAAGGG + Intronic
1196699433 X:118651632-118651654 CCTAGAAAGCATATTTAAAATGG + Intronic
1197010229 X:121552076-121552098 TCTAGAAAATAACCTCAAAAGGG + Intergenic
1197025164 X:121739328-121739350 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1197052412 X:122076042-122076064 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1197054068 X:122095642-122095664 TCTATAAAATAGTCTCAAAAGGG + Intergenic
1197075965 X:122352605-122352627 TCTAGAAAGCAGATCCAAAAGGG + Intergenic
1197113083 X:122799105-122799127 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1197139410 X:123099539-123099561 TGTAGAAAACAGCCTCAAAGGGG + Intergenic
1197307824 X:124864606-124864628 TCTAGAAAATAACCTTAAAGGGG + Intronic
1197363050 X:125531358-125531380 TCTAGAAAATAGCCTCAAAGAGG - Intergenic
1197365368 X:125559026-125559048 TCTAGAAAATAACCTCAAAAGGG + Intergenic
1197380690 X:125735405-125735427 TCTAAAAAATAGCCTCAAAAGGG - Intergenic
1197424460 X:126278379-126278401 TCTGGAAAGCAGACTAAAATGGG + Intergenic
1197492156 X:127130507-127130529 TTTAGAAAACAGCCTCAAAAGGG + Intergenic
1197508381 X:127337841-127337863 TCTACAAAAAAAAATTAAAATGG - Intergenic
1197520234 X:127488785-127488807 TTTAGAAAAGAGCCTCAAAAGGG - Intergenic
1197537742 X:127710385-127710407 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1197602451 X:128546713-128546735 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1197676564 X:129336837-129336859 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1197876379 X:131113314-131113336 TCTAGATAATAGCCTCAAAAAGG - Intergenic
1197953318 X:131920553-131920575 CCTAGAAAATAGCCTCAAAAGGG + Intergenic
1197954495 X:131931383-131931405 TGTAGAAAAAAGACTTTGAAAGG - Intergenic
1198143349 X:133828519-133828541 TATAGAAAACAAATTAAAAATGG + Intronic
1198190646 X:134300955-134300977 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1198274067 X:135084817-135084839 TCTACAAAATAGCCTCAAAAGGG - Intergenic
1198430636 X:136563343-136563365 TCTAGAAAATAGCCCCAAAAGGG - Intergenic
1198515037 X:137398910-137398932 TCTAGAAAATAGCTTCAAAAGGG - Intergenic
1198578680 X:138038559-138038581 TCTAGAAAATAGCCTCCAAAGGG + Intergenic
1198589867 X:138166267-138166289 TCTAAAAAACAAACAAAAAAAGG + Intergenic
1198677450 X:139145908-139145930 TCAAGAAAAGACACTAAAAAAGG + Intronic
1198695044 X:139326456-139326478 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1198702404 X:139412429-139412451 TTTAGAAAACAGCCTCAAAAGGG - Intergenic
1198781640 X:140243673-140243695 TCTAGAGAACAGATTCAAAAGGG - Intergenic
1198817907 X:140613000-140613022 TCTAGAAAAAAGCCTCAAAAGGG - Intergenic
1198841185 X:140859922-140859944 TCTAGAAAATAGCCACAAAATGG + Intergenic
1198887074 X:141351331-141351353 TCAGGAATACAGAATTAAAATGG - Intergenic
1198925441 X:141786948-141786970 TCTAGAAAATAGCCTCAAAAAGG - Intergenic
1198927296 X:141813482-141813504 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1198947346 X:142029517-142029539 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1198982119 X:142409845-142409867 TCTAAAAAACAGTCTCAAAAGGG + Intergenic
1199005903 X:142695184-142695206 TCTTGAAAATAGCCTCAAAAGGG + Intergenic
1199032397 X:143015376-143015398 TCCAGAAAATAGCCTCAAAAGGG + Intergenic
1199138747 X:144285776-144285798 TCTAGGAAATAGCCTTAAAAGGG - Intergenic
1199144083 X:144345577-144345599 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1199145721 X:144363890-144363912 TCTAGAAAATAGCCTCAAAGGGG + Intergenic
1199163695 X:144646012-144646034 TTTAGAACACAGCCTCAAAAGGG - Intergenic
1199189629 X:144954584-144954606 TCTAGAAAATTGCCTCAAAAGGG + Intergenic
1199196394 X:145036265-145036287 TCTAGGAAATAGCCTCAAAAGGG - Intergenic
1199217761 X:145280976-145280998 TCTAGAAAAAACCCTTAACAGGG - Intergenic
1199244385 X:145585936-145585958 TCTCGAAAACAAACAAAAAATGG - Intergenic
1199304093 X:146246539-146246561 TCTAAAAAATAGTCTCAAAAAGG + Intergenic
1199308537 X:146296353-146296375 TCTAGGAAATAGCCTCAAAATGG - Intergenic
1199341787 X:146687547-146687569 TCTAGAAAATAGCATCAAAAGGG - Intergenic
1199415243 X:147574465-147574487 TCTAGAAAATAACCTCAAAAGGG + Intergenic
1199568595 X:149245089-149245111 TCTGGAAAATAGCCTCAAAAGGG - Intergenic
1199859366 X:151786811-151786833 TACAGAAAACAGAATTAACAAGG + Intergenic
1200054534 X:153452680-153452702 TTTAAAAAACAGAGTTAAAGAGG + Intronic
1200323512 X:155214607-155214629 TTTTTAAAACAGACTTTAAAAGG - Intronic
1200369843 X:155713836-155713858 TCTGGAAAATAGTCTCAAAAGGG - Intergenic
1200370701 X:155721299-155721321 TCTAGAAAATAGCCTGAAAAAGG + Intergenic
1200379645 X:155821176-155821198 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
1200417883 Y:2931749-2931771 ATAAGAAAACAGACTGAAAAAGG + Intronic
1200449033 Y:3300969-3300991 TCTAGAAAATTGCCTGAAAATGG + Intergenic
1200458607 Y:3425801-3425823 CCTACAAAACAGACCAAAAAGGG + Intergenic
1200511479 Y:4085028-4085050 TCTAGAAAATAGCCTCAAAAGGG + Intergenic
1200550106 Y:4569073-4569095 CCTAGAAAACAAAACTAAAATGG + Intergenic
1200555146 Y:4628906-4628928 TCTAGAAAACAACCTCAAAAGGG - Intergenic
1200576016 Y:4890328-4890350 TCTAGAAAATAGCCTCAAAACGG - Intergenic
1200608437 Y:5295702-5295724 TCTAGGAAATAGCCTAAAAAGGG - Intronic
1200646950 Y:5797686-5797708 TCTAGAAAATAGCCTCAAAAGGG - Intergenic
1200656761 Y:5911605-5911627 TCTAGAAAATACCCTCAAAAGGG + Intergenic
1200660687 Y:5952976-5952998 TCTAGAAAATAGCCTCAAATGGG + Intergenic
1201465976 Y:14281500-14281522 TTTATAAATTAGACTTAAAAAGG - Intergenic
1201479830 Y:14427664-14427686 TCTAGAAAACAGACTCATTATGG + Intergenic
1201978900 Y:19885114-19885136 TCAGGAAAGCAGTCTTAAAAGGG + Intergenic
1202035621 Y:20631892-20631914 TCTATAAAATAGCCTAAAAATGG - Intergenic