ID: 1097148351

View in Genome Browser
Species Human (GRCh38)
Location 12:56957406-56957428
Sequence ACTACCTTCTGCACTGGTAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097148351_1097148354 0 Left 1097148351 12:56957406-56957428 CCGGTACCAGTGCAGAAGGTAGT 0: 3
1: 0
2: 1
3: 7
4: 64
Right 1097148354 12:56957429-56957451 ACAGGCCCACGAAAACCGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 112
1097148351_1097148357 13 Left 1097148351 12:56957406-56957428 CCGGTACCAGTGCAGAAGGTAGT 0: 3
1: 0
2: 1
3: 7
4: 64
Right 1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 5
4: 87
1097148351_1097148360 24 Left 1097148351 12:56957406-56957428 CCGGTACCAGTGCAGAAGGTAGT 0: 3
1: 0
2: 1
3: 7
4: 64
Right 1097148360 12:56957453-56957475 AGAGCCACATGGCTTTGCAGAGG 0: 3
1: 0
2: 4
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097148351 Original CRISPR ACTACCTTCTGCACTGGTAC CGG (reversed) Exonic