ID: 1097148357

View in Genome Browser
Species Human (GRCh38)
Location 12:56957442-56957464
Sequence AACCGCCAGGTAGAGCCACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097148353_1097148357 7 Left 1097148353 12:56957412-56957434 CCAGTGCAGAAGGTAGTACAGGC 0: 2
1: 2
2: 0
3: 13
4: 395
Right 1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 5
4: 87
1097148350_1097148357 14 Left 1097148350 12:56957405-56957427 CCCGGTACCAGTGCAGAAGGTAG 0: 2
1: 2
2: 0
3: 10
4: 117
Right 1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 5
4: 87
1097148347_1097148357 23 Left 1097148347 12:56957396-56957418 CCTGCCTCTCCCGGTACCAGTGC 0: 2
1: 1
2: 0
3: 17
4: 201
Right 1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 5
4: 87
1097148348_1097148357 19 Left 1097148348 12:56957400-56957422 CCTCTCCCGGTACCAGTGCAGAA 0: 2
1: 1
2: 1
3: 5
4: 83
Right 1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 5
4: 87
1097148351_1097148357 13 Left 1097148351 12:56957406-56957428 CCGGTACCAGTGCAGAAGGTAGT 0: 3
1: 0
2: 1
3: 7
4: 64
Right 1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG 0: 1
1: 1
2: 1
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097148357 Original CRISPR AACCGCCAGGTAGAGCCACA TGG Exonic
904959071 1:34316655-34316677 CTGCGCCATGTAGAGCCACAGGG + Intergenic
905732679 1:40307421-40307443 AAGTGTCAGGTGGAGCCACAGGG - Intronic
913211802 1:116588680-116588702 AACAGCCAGGTAAGGCCGCAGGG - Exonic
919101550 1:193103288-193103310 AACTGCAAGTTACAGCCACAAGG + Intronic
921662061 1:217815341-217815363 AACCTCCAGATATAGCCAGAAGG - Intronic
923544448 1:234914083-234914105 AAACGCCAAGTGCAGCCACAGGG - Intergenic
1062877366 10:953999-954021 GCCTGCCAGGCAGAGCCACATGG + Intergenic
1069415251 10:68194504-68194526 AACCCCCAGGTGGAGACGCAGGG + Exonic
1070527680 10:77309438-77309460 AACCGCCACGTTGTGACACATGG + Intronic
1081880896 11:46450726-46450748 AGCCACCATGTACAGCCACAAGG + Intronic
1084213488 11:67634526-67634548 ACCAGCCAGGTGCAGCCACAGGG - Intronic
1085781580 11:79413958-79413980 AAGCTCCATGCAGAGCCACAAGG - Intronic
1086268848 11:85035098-85035120 AAACACCAGATAAAGCCACAGGG - Intronic
1087169656 11:95037887-95037909 AGCAGCCAGGAAGAGCCACGCGG + Intergenic
1087172798 11:95067524-95067546 AGCCGCCAGGGAGAGCCACGCGG + Exonic
1088769826 11:113022824-113022846 AGCAGCCATGTTGAGCCACAAGG - Intronic
1091124586 11:133083039-133083061 CACTGCCTGGTGGAGCCACAGGG + Intronic
1097146268 12:56941462-56941484 GACCACCAGGTAGAGCCACATGG + Intergenic
1097148357 12:56957442-56957464 AACCGCCAGGTAGAGCCACATGG + Exonic
1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG + Intergenic
1104236294 12:126940848-126940870 AACCAACATGTAGAGTCACAAGG + Intergenic
1104619432 12:130299811-130299833 AAACAGCAGGAAGAGCCACAAGG - Intergenic
1105215058 13:18279306-18279328 AACAGCCAGGTAAGGCCGCAGGG - Intergenic
1105669143 13:22593028-22593050 CACTGCCAGGCAAAGCCACAAGG + Intergenic
1106588068 13:31074136-31074158 AACAGCCAGACAGAGACACATGG - Intergenic
1113385347 13:109843055-109843077 CCCCGCCTGGCAGAGCCACAGGG + Intergenic
1120189119 14:81423847-81423869 AACTGCCAGGGACAGCCACAAGG + Intronic
1121495609 14:94389776-94389798 ACTCGCCTGGTAGAGCCCCAAGG - Intronic
1122788431 14:104174461-104174483 ACCCCCCAGGGAGGGCCACATGG - Intronic
1127670995 15:61194769-61194791 AAAACACAGGTAGAGCCACACGG + Intronic
1128342424 15:66831783-66831805 GTCCTCCAGGAAGAGCCACACGG - Intergenic
1128617986 15:69125476-69125498 TACCGCCAGGTGGAGGGACATGG - Intergenic
1129737095 15:77972580-77972602 TCCAGCCAGGTAGACCCACAGGG + Intergenic
1129848985 15:78781055-78781077 TCCAGCCAGGTAGACCCACAGGG - Intronic
1130338735 15:82980507-82980529 ACACGCCACGCAGAGCCACATGG - Intronic
1133234320 16:4380789-4380811 ACACGCCAGGAAGAGCCAGAGGG - Intronic
1136549115 16:30972907-30972929 AAGCACCAGGAAGAGGCACAGGG + Intronic
1143606609 17:7990333-7990355 AGCCGCCAGGGGGAGCCCCAAGG - Intergenic
1144194416 17:12876366-12876388 AATCAGCAGGTAGCGCCACATGG - Intronic
1144703697 17:17354053-17354075 GAGCCCCAGGTAGAGCCCCAAGG + Intergenic
1145104636 17:20104950-20104972 AACCACCATGGAGAGCCACTAGG + Intronic
1145259042 17:21343861-21343883 AGCCGACAGGCAGGGCCACAGGG - Intergenic
1145317576 17:21744142-21744164 AGCCGACAGGCAGGGCCACAGGG + Intergenic
1147671981 17:42181411-42181433 ACCCGCGAGGTGGAGCCACAAGG - Intergenic
1151605265 17:75131531-75131553 TACCGCCAGGTCGGGCCGCAGGG + Exonic
1151693322 17:75700803-75700825 ACCCGCCAGGCAGAGACAAACGG + Intronic
1151954568 17:77373944-77373966 AGCCGCCGGGGAGAGCCAAAGGG - Intronic
1161001327 19:1912605-1912627 CGCCGCCATGCAGAGCCACATGG + Exonic
1164973098 19:32549259-32549281 AAACACCAGCTTGAGCCACACGG + Intergenic
1165805865 19:38580260-38580282 GGCAGCAAGGTAGAGCCACAGGG + Intronic
925130947 2:1493663-1493685 AACTGCCAGGCAGTGTCACAGGG + Intronic
932448332 2:71794191-71794213 TATCTACAGGTAGAGCCACAGGG + Intergenic
934299262 2:91767431-91767453 AACAGCCAGGTAAGGCCGCAGGG + Intergenic
934567783 2:95350114-95350136 AGGCTCCAGGGAGAGCCACAGGG - Intronic
937132264 2:119522782-119522804 CAAAGCCAGGTAGAGCCAGAAGG - Intronic
947324457 2:228959331-228959353 AACAGTCAGGTAGACACACAGGG + Intronic
947828234 2:233120753-233120775 AACTACCGGCTAGAGCCACAGGG + Intronic
948236176 2:236392919-236392941 AACCACCAGGAAGAGGCAAAAGG - Intronic
1170415097 20:16131074-16131096 AGCTGCCAGATAGAGCCACATGG - Intergenic
1173186200 20:40842485-40842507 ACCTGCCAGGTACAGCCACCAGG + Intergenic
1175711074 20:61221578-61221600 AACAGCCAGATAGAGCACCAAGG + Intergenic
1176376700 21:6090354-6090376 AAAACCCAGGGAGAGCCACATGG + Intergenic
1179746775 21:43447890-43447912 AAAACCCAGGGAGAGCCACATGG - Intergenic
1182718834 22:32381242-32381264 ATCCTCCAGGTACAACCACAGGG - Intronic
1185319062 22:50192168-50192190 AACATTCAGGAAGAGCCACATGG + Intronic
955195427 3:56801434-56801456 GACCGGCAGGTAGAGGGACAGGG + Intronic
969721088 4:8893410-8893432 AACCGATGGGTAGGGCCACAGGG - Intergenic
969725870 4:8917762-8917784 CACAGCCTGGGAGAGCCACAGGG + Intergenic
979225461 4:118279116-118279138 AACCGTCAGTTTGAGCCAGATGG + Intergenic
979785467 4:124712057-124712079 AACCGCCCAGAGGAGCCACAGGG + Intronic
983303147 4:165953305-165953327 AACCGTGAGGTACAGCCAGATGG + Intronic
990043241 5:51397577-51397599 AAACGCTAAGTAAAGCCACATGG - Intergenic
992082027 5:73242959-73242981 AACCTCCATGTGGAGACACATGG - Intergenic
1001866424 5:175109678-175109700 AACCTCCAGGGAGAGGCAGAAGG - Intergenic
1007465397 6:42048222-42048244 AACAGCCCGGTAAAGCCACGGGG + Intronic
1008592825 6:53010938-53010960 AACAGCCAGGCAGGGCCACTGGG - Intronic
1016865139 6:148758957-148758979 AACCGTCAGGCAGAGCCATGCGG + Intronic
1019187647 6:170230174-170230196 CACCGCCACGGAGAGCCACACGG + Intergenic
1021610959 7:22457684-22457706 AACTGCCAGGTGCAGTCACATGG - Intronic
1024527442 7:50360815-50360837 CAGCGCCGGGCAGAGCCACATGG - Intronic
1024573916 7:50748375-50748397 AACAGCCAGGGAGAGCGTCACGG + Intronic
1029892490 7:103945019-103945041 CACTGCCAGGTAGAACTACAAGG - Intronic
1030098572 7:105923693-105923715 AATCGCCAGGCAGAGCTCCAGGG - Intronic
1035330359 7:158092810-158092832 AGCCTCGAGGTAGAGGCACAGGG + Intronic
1037281535 8:17247172-17247194 AACCGCCGGGCCGAGCCACTGGG + Exonic
1039117507 8:34108633-34108655 AACCGCCATGTCGAGCCTCCAGG + Intergenic
1040694555 8:49979847-49979869 AACAGCCAGGCAGATGCACATGG + Intronic
1041153850 8:54963564-54963586 AACCTCCCAGAAGAGCCACAGGG - Intergenic
1041832118 8:62165409-62165431 AACCACCCGGTAGAGCTACTGGG - Intergenic
1046650603 8:116833083-116833105 CACCTCCAGGAACAGCCACAGGG + Intronic
1050135365 9:2457827-2457849 ATCCGCTAGGTAGAGAAACAAGG + Intergenic
1051368440 9:16337907-16337929 AACTACCAGGTAGAGTTACAGGG + Intergenic
1053065924 9:35069175-35069197 AACCGCCAGAAAGAGGCTCAAGG + Intronic
1060437745 9:123609392-123609414 AAGCCCCAGGTAGAGCCATCTGG + Intronic
1186215502 X:7296110-7296132 AACCTCCAGACTGAGCCACAAGG - Intronic