ID: 1097151978

View in Genome Browser
Species Human (GRCh38)
Location 12:56985904-56985926
Sequence ACTACCTTCTGCACTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097151978_1097151986 13 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data
1097151978_1097151982 -9 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151982 12:56985918-56985940 GAAGGTAGTATAGGCCCAGGAGG No data
1097151978_1097151989 24 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data
1097151978_1097151983 0 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151983 12:56985927-56985949 ATAGGCCCAGGAGGACCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097151978 Original CRISPR ACTACCTTCTGCACTGGTAC TGG (reversed) Intergenic
No off target data available for this crispr