ID: 1097151982

View in Genome Browser
Species Human (GRCh38)
Location 12:56985918-56985940
Sequence GAAGGTAGTATAGGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097151974_1097151982 1 Left 1097151974 12:56985894-56985916 CCTGCCTCTCCCAGTACCAGTGC No data
Right 1097151982 12:56985918-56985940 GAAGGTAGTATAGGCCCAGGAGG No data
1097151978_1097151982 -9 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151982 12:56985918-56985940 GAAGGTAGTATAGGCCCAGGAGG No data
1097151977_1097151982 -8 Left 1097151977 12:56985903-56985925 CCCAGTACCAGTGCAGAAGGTAG No data
Right 1097151982 12:56985918-56985940 GAAGGTAGTATAGGCCCAGGAGG No data
1097151973_1097151982 4 Left 1097151973 12:56985891-56985913 CCACCTGCCTCTCCCAGTACCAG No data
Right 1097151982 12:56985918-56985940 GAAGGTAGTATAGGCCCAGGAGG No data
1097151975_1097151982 -3 Left 1097151975 12:56985898-56985920 CCTCTCCCAGTACCAGTGCAGAA No data
Right 1097151982 12:56985918-56985940 GAAGGTAGTATAGGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097151982 Original CRISPR GAAGGTAGTATAGGCCCAGG AGG Intergenic