ID: 1097151986

View in Genome Browser
Species Human (GRCh38)
Location 12:56985940-56985962
Sequence GACCGCCAGGTAGAGCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097151975_1097151986 19 Left 1097151975 12:56985898-56985920 CCTCTCCCAGTACCAGTGCAGAA No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data
1097151980_1097151986 7 Left 1097151980 12:56985910-56985932 CCAGTGCAGAAGGTAGTATAGGC No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data
1097151978_1097151986 13 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data
1097151974_1097151986 23 Left 1097151974 12:56985894-56985916 CCTGCCTCTCCCAGTACCAGTGC No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data
1097151973_1097151986 26 Left 1097151973 12:56985891-56985913 CCACCTGCCTCTCCCAGTACCAG No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data
1097151977_1097151986 14 Left 1097151977 12:56985903-56985925 CCCAGTACCAGTGCAGAAGGTAG No data
Right 1097151986 12:56985940-56985962 GACCGCCAGGTAGAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097151986 Original CRISPR GACCGCCAGGTAGAGCCACA TGG Intergenic