ID: 1097151989

View in Genome Browser
Species Human (GRCh38)
Location 12:56985951-56985973
Sequence AGAGCCACATGGCTTTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097151977_1097151989 25 Left 1097151977 12:56985903-56985925 CCCAGTACCAGTGCAGAAGGTAG No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data
1097151980_1097151989 18 Left 1097151980 12:56985910-56985932 CCAGTGCAGAAGGTAGTATAGGC No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data
1097151985_1097151989 -5 Left 1097151985 12:56985933-56985955 CCAGGAGGACCGCCAGGTAGAGC No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data
1097151978_1097151989 24 Left 1097151978 12:56985904-56985926 CCAGTACCAGTGCAGAAGGTAGT No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data
1097151984_1097151989 -4 Left 1097151984 12:56985932-56985954 CCCAGGAGGACCGCCAGGTAGAG No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data
1097151975_1097151989 30 Left 1097151975 12:56985898-56985920 CCTCTCCCAGTACCAGTGCAGAA No data
Right 1097151989 12:56985951-56985973 AGAGCCACATGGCTTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097151989 Original CRISPR AGAGCCACATGGCTTTGCAG AGG Intergenic