ID: 1097155791

View in Genome Browser
Species Human (GRCh38)
Location 12:57011381-57011403
Sequence TTCACTAGCTTCCAAAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097155791_1097155795 15 Left 1097155791 12:57011381-57011403 CCAATTCTTTGGAAGCTAGTGAA 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1097155795 12:57011419-57011441 GGAGCTGCTCTTGCTGTGTGTGG 0: 1
1: 0
2: 4
3: 51
4: 398
1097155791_1097155796 16 Left 1097155791 12:57011381-57011403 CCAATTCTTTGGAAGCTAGTGAA 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1097155796 12:57011420-57011442 GAGCTGCTCTTGCTGTGTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 241
1097155791_1097155792 -9 Left 1097155791 12:57011381-57011403 CCAATTCTTTGGAAGCTAGTGAA 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1097155792 12:57011395-57011417 GCTAGTGAAAAGAAAGCCATTGG 0: 1
1: 0
2: 0
3: 16
4: 199
1097155791_1097155793 -6 Left 1097155791 12:57011381-57011403 CCAATTCTTTGGAAGCTAGTGAA 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1097155793 12:57011398-57011420 AGTGAAAAGAAAGCCATTGGTGG 0: 1
1: 0
2: 5
3: 38
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097155791 Original CRISPR TTCACTAGCTTCCAAAGAAT TGG (reversed) Intronic
901157964 1:7153449-7153471 TGCCTTAGCTTCCAAAGAAATGG + Intronic
901690891 1:10972700-10972722 TTAACTTGGGTCCAAAGAATTGG + Intronic
903431477 1:23304537-23304559 TTCACTACCTTCCTTAGAACAGG + Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
909031571 1:70547459-70547481 TACACTAGCTTTCAAAGACTTGG + Intergenic
909500044 1:76324204-76324226 TTCACTATCATTTAAAGAATAGG + Intronic
909521339 1:76571801-76571823 ATCACTAGCTTACAAACCATTGG - Intronic
909908876 1:81235708-81235730 TTCATTAGGATCCAAAAAATAGG + Intergenic
910059433 1:83070734-83070756 TTAACTTGCTGCCAAAGAACTGG - Intergenic
911500837 1:98682437-98682459 TAAAGAAGCTTCCAAAGAATAGG + Intronic
912426215 1:109593941-109593963 TTCACTAGTTTACAAAAAAAAGG + Exonic
912949438 1:114110639-114110661 TTCAGCAGCTTGTAAAGAATGGG + Intronic
913665411 1:121043736-121043758 TTCACTACCCTCCAAAAAAATGG - Intergenic
914016808 1:143827007-143827029 TTCACTACCCTCCAAAAAAATGG - Intergenic
914160978 1:145134004-145134026 TTCACTACCCTCCAAAAAAATGG + Intergenic
914655418 1:149735548-149735570 TTCACTACCCTCCAAAAAAATGG - Intergenic
915957504 1:160234106-160234128 TTCATTAGCTTTCAGAGACTTGG + Intronic
917497190 1:175551373-175551395 TCCACTAGCTTCCTTAGAAATGG - Intronic
918746081 1:188201983-188202005 TTCACTAGCTTAAATAGACTTGG - Intergenic
919376661 1:196803236-196803258 CTCACTATCTTCCCAAGATTTGG + Intergenic
919386367 1:196928128-196928150 CTCACTATCTTCCCAAGATTTGG + Intronic
922645274 1:227280244-227280266 TTCACTAGCTTACAAACCAGTGG - Intronic
923316666 1:232786977-232786999 TTCAGTAGCTTCACAAGAGTTGG - Intergenic
923807594 1:237275803-237275825 TTCAGTAAGTTCCAAAGAATAGG + Intronic
1065147093 10:22780652-22780674 TTCATGAGCTTGCAAAGAAGAGG - Intergenic
1065255444 10:23862152-23862174 TTCAGTGGCTCCCAAAGAGTTGG + Intronic
1067020179 10:42789801-42789823 GTCTCTGGCATCCAAAGAATGGG - Intronic
1068490416 10:57716760-57716782 TTTACAAGTTTCCTAAGAATTGG - Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1069073500 10:64014299-64014321 TTCACAAAGTTCCAAAGATTAGG + Intergenic
1069675962 10:70247957-70247979 TTCAATGGCTTCCAAAGATTTGG - Exonic
1071226888 10:83540768-83540790 TTCACTCTCTTTCAAAGTATAGG + Intergenic
1071867403 10:89750141-89750163 TTTGCTAGCTTTCAAATAATAGG + Intronic
1072572305 10:96669455-96669477 TTAAGGAGCTTCCAATGAATTGG + Intronic
1075261226 10:120965182-120965204 TTCAGTAGCTCCCATAGACTAGG - Intergenic
1080371650 11:31653305-31653327 GTCACCAGTTTTCAAAGAATTGG - Intronic
1082054934 11:47806126-47806148 TTCACTGGCTTCTAAATAAAAGG + Intronic
1084016354 11:66384858-66384880 GCAACTAGCCTCCAAAGAATAGG - Intergenic
1084619369 11:70258524-70258546 TTTACTTGCTTGTAAAGAATGGG + Intergenic
1086511137 11:87559455-87559477 TTCCATAGCTTCCAAAGTACAGG + Intergenic
1088113794 11:106293804-106293826 TTCACTAGTTTCCTAAGAAATGG + Intergenic
1093289785 12:17305413-17305435 TTGAATAGCTTCAATAGAATTGG + Intergenic
1096173583 12:49494938-49494960 TTCAATAGATGCCAGAGAATTGG + Exonic
1096775758 12:53963065-53963087 TTCAAGAGCTTCCAAAGGCTAGG + Intergenic
1097155791 12:57011381-57011403 TTCACTAGCTTCCAAAGAATTGG - Intronic
1097645365 12:62230375-62230397 TTTACTAGATCCCATAGAATTGG + Intronic
1097816826 12:64083516-64083538 TTCAGTAGTTTTCAAAGATTTGG - Intronic
1099390819 12:82076809-82076831 TTGAATAGTTTCAAAAGAATTGG + Intergenic
1099453602 12:82837728-82837750 ATCAGTAGCTGCCAAAGAAATGG + Intronic
1100108573 12:91208741-91208763 TTAATTAGCTTCCAATGTATAGG + Intergenic
1101973011 12:109330459-109330481 TTCCTTAGCTTCCAAAGCACAGG - Intergenic
1102633312 12:114300926-114300948 TTCACTAGCCTCCTGAGGATGGG - Intergenic
1105693599 13:22865849-22865871 ACCACCAACTTCCAAAGAATTGG - Intergenic
1106574289 13:30960121-30960143 TCCAGTAGCTTCCTAAGAAAGGG - Intronic
1108507365 13:51124594-51124616 TTCACTGTCTTCCAAAGCTTAGG - Intergenic
1108565194 13:51689727-51689749 TTCACTGGCTACCAAACAATGGG - Intronic
1108735862 13:53282637-53282659 TTCCCTAGCTTCCACATAAGTGG - Intergenic
1109415332 13:62032094-62032116 TTGACTAGCTTTCAGAGAAAGGG - Intergenic
1110386564 13:74918926-74918948 TTCAATAACTTCTAAAGAAATGG + Intergenic
1111468678 13:88648210-88648232 CTCCCTAGAATCCAAAGAATGGG + Intergenic
1113333907 13:109359673-109359695 CTCACTAGCTGCCAATGGATAGG + Intergenic
1115922219 14:38388360-38388382 GTGACTTGCTTCCATAGAATAGG + Intergenic
1121383082 14:93491400-93491422 TTAACTAGATTCCAAATAAATGG - Intronic
1121663700 14:95655408-95655430 TCCAGTAGCTTCCTAAGAAAGGG + Intergenic
1122079844 14:99258931-99258953 TTTATTAGCTTCCAAATATTTGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124085132 15:26542498-26542520 TTTACTGGCTTCTAAAGGATAGG - Intergenic
1127255882 15:57292356-57292378 TTCACAAGCTTTGAAAGACTTGG - Intronic
1127685884 15:61343299-61343321 TTCAGTAGCTTCTTAAGAAAGGG + Intergenic
1130429589 15:83833205-83833227 GTCACTAGCTACCATAGATTGGG + Intronic
1132180252 15:99747443-99747465 TTCAGTAGCATCCTAAGAAAAGG - Intergenic
1135807893 16:25559740-25559762 TGCAATAGTTTCCAAAGAAATGG - Intergenic
1138967238 16:62099242-62099264 TTCCCTAGTTTCCAAAAAGTGGG - Intergenic
1140679413 16:77369682-77369704 TTCAATAGTTTGCAAAGGATTGG - Intronic
1141192157 16:81832772-81832794 TTCTCTAGCTTTGCAAGAATGGG - Intronic
1141453573 16:84122101-84122123 CCCAGTAGCTTCCAAAGACTAGG + Intergenic
1141547825 16:84783741-84783763 TTCTCTGGCTTCCTAGGAATTGG + Intergenic
1143424217 17:6820839-6820861 TTCAGTAACTTCCTAAGAAATGG + Intronic
1147969055 17:44210079-44210101 TTCCCGAGCTTTCAATGAATGGG + Intronic
1149777201 17:59367304-59367326 TTCACTAACTTCCAGAGTAGGGG + Intronic
1151496112 17:74459196-74459218 ATCTCTAGCTTCTAGAGAATAGG - Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1152107197 17:78337560-78337582 ATCACTAGGAGCCAAAGAATGGG - Intergenic
1153120926 18:1725938-1725960 TTCAATAGCTTTAAAAGAAATGG - Intergenic
1155014912 18:21825221-21825243 GTCACTATCTTCCATAGTATTGG - Intronic
1155704532 18:28792470-28792492 TTCACTATATTGCAAATAATAGG - Intergenic
1155847089 18:30721507-30721529 ATCAATAGCATCAAAAGAATGGG + Intergenic
1157125668 18:44953426-44953448 TTCACTAGTTTGCAAAGAGGTGG + Intronic
1157653048 18:49356648-49356670 TTCACTCTCTTCCAACGACTTGG + Intronic
1157967326 18:52222991-52223013 TTGAATGGCTGCCAAAGAATGGG - Intergenic
1159560974 18:69994034-69994056 CTCAATACATTCCAAAGAATAGG - Intergenic
1161896910 19:7089406-7089428 TTCTCCAGCTTCCAAACAAATGG + Intergenic
1164724180 19:30454064-30454086 CTCACTTGCTTCCAAAGGACAGG + Intronic
925613463 2:5722918-5722940 TTTACTAGCTACTAAAGATTGGG + Intergenic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
928026640 2:27745015-27745037 TTCACTATCTTCCTAAGAAAAGG + Intergenic
928043633 2:27904829-27904851 TCCACTAGCATCCTAAGAAAGGG - Intronic
928441309 2:31294612-31294634 TTTGTTAACTTCCAAAGAATTGG - Intergenic
929970424 2:46569640-46569662 TTCTCTAGCTCCTAAATAATTGG + Intronic
930836049 2:55794340-55794362 CTCAATAGCTTCCAGAGAAAGGG + Intergenic
933481222 2:82859269-82859291 TCCATTAGCTTCCCAAGAAAGGG - Intergenic
936565984 2:113583255-113583277 TTCACTAGCTTTTTAAAAATTGG + Intergenic
940352117 2:152702286-152702308 TTAACAAGCCTCCAGAGAATAGG + Intronic
944792881 2:203151475-203151497 TTAGCTAGCTTCCAGTGAATTGG - Exonic
944969906 2:204980470-204980492 ATGACTTACTTCCAAAGAATAGG + Intronic
945276746 2:207995460-207995482 ACCACTAGCTTCCAAAGTAAGGG + Intronic
945330309 2:208531505-208531527 TTCACTAACTTTCACAGAAATGG - Intronic
947370492 2:229440587-229440609 TTCTCTAGCATCCATACAATGGG + Intronic
1168883857 20:1229807-1229829 GTCAGTAACTTTCAAAGAATAGG + Intronic
1169600419 20:7253709-7253731 TTCACTAGCAGCAAAAAAATTGG - Intergenic
1171058041 20:21927102-21927124 TCCAATAGCTTCCCAAGAAAGGG + Intergenic
1171996743 20:31737366-31737388 GGCACTGGCTTCCAAATAATTGG - Intergenic
1172123578 20:32612455-32612477 TTCCCTCCCTTCCAAAGACTAGG + Intergenic
1173343746 20:42178998-42179020 GTGACTGGCTTCCAATGAATAGG - Intronic
1174916859 20:54662733-54662755 TTCAGTAGCTTCCAATAACTAGG + Intergenic
1180238440 21:46480646-46480668 TTCCCTTGCTGCCAAAGAACGGG - Intronic
1183352692 22:37342891-37342913 TTCTCCATCTTCCAATGAATGGG - Intergenic
949326931 3:2876488-2876510 TTTACTAACTTCCACAGAGTGGG - Intronic
949581860 3:5396556-5396578 TTTAGAAGCTTCCTAAGAATAGG - Intergenic
952329179 3:32348064-32348086 TTCAGTAGATTCCTAAGAAAGGG + Intronic
953895657 3:46797861-46797883 GTAACTTGCTTCCAAAGAATTGG + Intronic
953921148 3:46952582-46952604 TTAACTAGGTTCCATAAAATTGG + Intronic
955513269 3:59702145-59702167 TACACTAGATTCCAAAGGTTAGG - Intergenic
956526106 3:70163851-70163873 TGCACTAGCTACCAAACACTAGG + Intergenic
956562712 3:70598697-70598719 TTCAATGGCTTCCACACAATTGG - Intergenic
957359658 3:79137832-79137854 TTCAATAGCATACAAACAATGGG + Intronic
957505131 3:81109698-81109720 CTCAATATCTTCCAAATAATTGG - Intergenic
957988573 3:87602488-87602510 TTCACTGCCTTCCAAAGCCTTGG - Intergenic
958068423 3:88576449-88576471 TTTACTTTCTTCTAAAGAATAGG + Intergenic
958768438 3:98397676-98397698 TTCACTATCTCCTATAGAATTGG - Intergenic
960376403 3:116907175-116907197 TTCACTAGCTTCCCAGGCTTCGG + Intronic
961138011 3:124530116-124530138 TTCACTTGCTACCAGGGAATTGG - Intronic
962354682 3:134683844-134683866 TTCATTAGCTTCCATTGACTGGG + Intronic
963177615 3:142316761-142316783 TTCAGTAGCTTCTTAAGAAAGGG + Intronic
963261773 3:143199766-143199788 TTCAGTAGGTTCCATAGATTAGG - Intergenic
964042673 3:152281480-152281502 TTCACTAGCTTTGAAAGGAGGGG + Intronic
965790168 3:172379017-172379039 TTCACTAGCTTCGAGAGATATGG - Intronic
966787395 3:183633923-183633945 TTAAATAGCTTCCTAAGAAAAGG - Intergenic
967027832 3:185579938-185579960 TTAACTGGCTTCCCAAGCATTGG + Intergenic
971090838 4:23343593-23343615 TCCATTAGGTTCAAAAGAATTGG - Intergenic
971390296 4:26179101-26179123 TTCACTATCTTCCAACCACTGGG - Intronic
971447420 4:26765780-26765802 TTCACTAGATTAGAAAAAATAGG - Intergenic
971812722 4:31447733-31447755 TCCAATAGCTTCCCAAGAAAGGG + Intergenic
972433698 4:39011256-39011278 TTCACAAGGTTGCAAAGAAAAGG + Intronic
973663004 4:53127172-53127194 TTCACTATATTTCAAACAATGGG + Intronic
973838120 4:54831524-54831546 TTAACCAGTTTACAAAGAATTGG + Intergenic
976480182 4:85534075-85534097 TTCACCAGCTTCCCTAGACTGGG - Intronic
976640156 4:87329332-87329354 TTCACAACCTTCCAACTAATTGG - Intergenic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977246919 4:94643272-94643294 TTGACTAGCTACGAATGAATAGG + Intronic
978419500 4:108515062-108515084 AGCACCAGCTTCCACAGAATGGG - Intergenic
978902578 4:113970561-113970583 CCCACTGGCTACCAAAGAATAGG - Intronic
978962691 4:114702905-114702927 GTCAATAGCTTCCAAAAACTTGG + Intergenic
979488970 4:121302592-121302614 TTCAGTAACTTACAAAGAAAGGG + Intergenic
983522956 4:168729738-168729760 TCCAGTAGCTTCCAAAGAAAGGG + Intronic
983554620 4:169049006-169049028 TTAACTAGCTGCCAAGCAATTGG + Intergenic
984813494 4:183817147-183817169 TTCACTAGCTTCCAAGAATGTGG - Intergenic
986100003 5:4599363-4599385 TTCACTAGGTAGCAAAGGATAGG - Intergenic
986460466 5:7965417-7965439 TTCAATAGCTTCTAATGCATAGG - Intergenic
987456173 5:18149888-18149910 TTCACTTGCTCCCAAGGAAAGGG - Intergenic
989176735 5:38535035-38535057 TGCAGTAGCTTCCAGAGAATGGG - Intronic
989400688 5:41004886-41004908 TTCCCATGCTTCCAAAGGATTGG + Exonic
989582705 5:43047927-43047949 TTCACCAGATTCCACAGAGTGGG + Intergenic
990597369 5:57324978-57325000 TTCATTAGCTGCCAGGGAATTGG + Intergenic
992075063 5:73184540-73184562 TTTACTAGGTTCCAGAGATTAGG - Intergenic
994950448 5:106454653-106454675 GTGACTAGCTTCTAAACAATAGG + Intergenic
995014494 5:107294632-107294654 TTCACTAACTTCAAATGAGTAGG - Intergenic
997018266 5:129963739-129963761 TTCATTTTCTTCCACAGAATTGG + Intronic
998974005 5:147624334-147624356 TGCACTGGGGTCCAAAGAATGGG + Intronic
1003936370 6:10978791-10978813 TAAACTAGCTTGAAAAGAATAGG + Intronic
1004785411 6:18962786-18962808 CTCACCAGCTTCCAATCAATGGG - Intergenic
1007802631 6:44409887-44409909 TTCAGTAGCTTTCAGAGAAAGGG + Intronic
1008391593 6:50958595-50958617 TTCTCTAGTTTCCAAAGTACAGG + Intergenic
1008401375 6:51067344-51067366 TCCAATACCTTCCACAGAATAGG - Intergenic
1012752380 6:103180347-103180369 GTGACTTGCTTTCAAAGAATAGG - Intergenic
1014997764 6:128172859-128172881 ATCAATATATTCCAAAGAATGGG + Intronic
1017240293 6:152160640-152160662 TTCATTAGCTTCCTGAAAATGGG + Intronic
1017348801 6:153415512-153415534 TTCACTTTCTTCCACAGACTTGG - Intergenic
1018003390 6:159599134-159599156 CCCAATAGCTTCCTAAGAATGGG + Intergenic
1018162181 6:161055847-161055869 GTGACTTACTTCCAAAGAATTGG - Intronic
1021472542 7:21021608-21021630 TTCTCTAGATAGCAAAGAATGGG - Intergenic
1023679869 7:42674556-42674578 TTTAGTAGCTTTTAAAGAATAGG - Intergenic
1024919764 7:54544897-54544919 GTCACTCGCTTCCACAGAACCGG - Intronic
1025710593 7:63904391-63904413 TTAAATATATTCCAAAGAATGGG + Intergenic
1027520669 7:79202702-79202724 ATCACTTTCTTCCACAGAATTGG + Intronic
1027764139 7:82318141-82318163 TTTGCTAGCTTCTAAAGCATAGG - Intronic
1030267513 7:107635437-107635459 TCCACTAGCTTCCCAAGAAAAGG - Intergenic
1033920694 7:146387784-146387806 TCCACCAGCTTCCTAAGAAAGGG + Intronic
1037395386 8:18436035-18436057 TTCACTAACTTTTAAAAAATGGG - Intergenic
1044014128 8:87030418-87030440 TTCACTATCTTTCAAAAAGTAGG - Intronic
1044429549 8:92092910-92092932 TGCAGTAGCTTCCAAATTATAGG + Intronic
1044505409 8:93011694-93011716 TTCACTATGTGCCAAAGACTGGG + Intronic
1044710168 8:95049586-95049608 TTCAGTAGATTCTAAAGAGTTGG + Intronic
1045890784 8:107154601-107154623 TTCAATACATTCCAAAGAAGGGG + Intergenic
1050721134 9:8591252-8591274 ATCACAAGGTTCCAAAGAATAGG + Intronic
1050980002 9:11997609-11997631 TTCACCAGCTTCTAAAGGCTGGG + Intergenic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1052703787 9:31969690-31969712 TTCAGTATCTTCCACAGAAAAGG - Intergenic
1058400411 9:104610958-104610980 TTCACTGGCATCCAAAGTGTTGG - Intergenic
1059802929 9:117769120-117769142 GTCACCACCTTCCAGAGAATAGG - Intergenic
1062022920 9:134327470-134327492 CTCACTAGCTTCCAAACCCTTGG - Intronic
1187023974 X:15413532-15413554 TCTACTAGCTTGCCAAGAATAGG + Intronic
1189084539 X:38007726-38007748 TTCACTAGAGTCCAAACAAATGG - Intronic
1189753238 X:44244599-44244621 TTGACTAGATTCCAACAAATTGG + Intronic
1190767540 X:53488118-53488140 TTTACTAGCTTTCAAAGGAGTGG + Intergenic
1193077705 X:77373061-77373083 ATCACCAGCTTCCAAGGAAGAGG + Intergenic
1194649229 X:96496280-96496302 ATCATTAGCTTTTAAAGAATTGG - Intergenic
1196422408 X:115536675-115536697 TTTGCTAACTTCCAAAGGATAGG - Intergenic
1201613996 Y:15875534-15875556 TTCTCTAGCTTTCTAAGAATTGG - Intergenic
1201616372 Y:15904246-15904268 TTCTCTAGCTTTCTAAGAATTGG + Intergenic
1202365842 Y:24163870-24163892 TTCACTAGGTACTAAAAAATGGG - Intergenic
1202504940 Y:25506252-25506274 TTCACTAGGTACTAAAAAATGGG + Intergenic