ID: 1097156637

View in Genome Browser
Species Human (GRCh38)
Location 12:57016613-57016635
Sequence CAGGGTGGCTGGAGGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2634
Summary {0: 1, 1: 2, 2: 22, 3: 219, 4: 2390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097156637 Original CRISPR CAGGGTGGCTGGAGGGGAGG CGG Intronic
Too many off-targets to display for this crispr