ID: 1097157973

View in Genome Browser
Species Human (GRCh38)
Location 12:57026583-57026605
Sequence TGGGTTGTTTCAGCCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097157973_1097157983 18 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157983 12:57026624-57026646 CTGGCTGAAGGGAGAGGGCTGGG 0: 1
1: 0
2: 2
3: 58
4: 532
1097157973_1097157982 17 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157982 12:57026623-57026645 ACTGGCTGAAGGGAGAGGGCTGG 0: 1
1: 0
2: 6
3: 53
4: 525
1097157973_1097157977 -1 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157977 12:57026605-57026627 AGACTCTCAGAGCGCTGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 74
1097157973_1097157978 6 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157978 12:57026612-57026634 CAGAGCGCTGAACTGGCTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 122
1097157973_1097157980 12 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157980 12:57026618-57026640 GCTGAACTGGCTGAAGGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 316
1097157973_1097157981 13 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157981 12:57026619-57026641 CTGAACTGGCTGAAGGGAGAGGG 0: 1
1: 0
2: 2
3: 27
4: 330
1097157973_1097157984 28 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157984 12:57026634-57026656 GGAGAGGGCTGGGAGAGAAGAGG 0: 1
1: 0
2: 14
3: 223
4: 1710
1097157973_1097157979 7 Left 1097157973 12:57026583-57026605 CCCTCAGAGGCTGAAACAACCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1097157979 12:57026613-57026635 AGAGCGCTGAACTGGCTGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097157973 Original CRISPR TGGGTTGTTTCAGCCTCTGA GGG (reversed) Intronic
903661993 1:24984057-24984079 TGGGATGTGTCAGGCTTTGAGGG + Intergenic
904293686 1:29504056-29504078 TGAGTTGTTTCGGCTTCTGAAGG - Intergenic
905378592 1:37543221-37543243 TGGGTATTTTCAGCCACTGCTGG + Intronic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
912581033 1:110721126-110721148 TGGGTTGTTGTAGGTTCTGACGG + Intergenic
915334801 1:155135000-155135022 TGGGATGTTTCCTCCTCTGAGGG + Intergenic
918050676 1:180969985-180970007 AGGGTTGTTTCAGCAGCTGATGG - Intergenic
918708307 1:187696203-187696225 TGGGCTGCTGCAGCCTCTGCAGG + Intergenic
920204716 1:204283061-204283083 TGGGCTGCCTCAGCCACTGAAGG - Intronic
923084334 1:230691438-230691460 TGGCTTGTTTCAGCCTTTTCAGG - Exonic
923217587 1:231863609-231863631 TGGGTTCTTTCAGACTCTTGGGG + Intronic
923777801 1:236995694-236995716 TGGGAAGTTTCAGCTTCTCATGG + Intergenic
1063029414 10:2217763-2217785 TGGGCTGCTTCAGGCACTGATGG - Intergenic
1064313540 10:14234237-14234259 GTGGTTGGTTCAGCCACTGATGG - Intronic
1075612431 10:123864391-123864413 TGGGGGGTTTCAGACCCTGATGG + Intronic
1077614964 11:3667843-3667865 TGGTTTCTTTCAGCCCCTGGGGG - Intronic
1078660271 11:13280006-13280028 TAGGTTGTGTTTGCCTCTGATGG + Intronic
1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG + Intronic
1083324693 11:61867252-61867274 TGGGTTCATTCTGCCTCTGCGGG - Exonic
1084679504 11:70658347-70658369 TGGGTTGAATCATCCTCTGTAGG - Intronic
1086845198 11:91740990-91741012 TGGTTTGTTTCTTCCTCTGAGGG + Intergenic
1087557548 11:99740691-99740713 TGAGTTGCTGCAACCTCTGATGG - Intronic
1089494097 11:118899817-118899839 TGGCTTTTTTGTGCCTCTGAAGG - Intronic
1094059693 12:26300580-26300602 CTGGTTGTTTCAGCCACTGCAGG + Intergenic
1095332988 12:40991160-40991182 TTGCTTCTTTCAGCTTCTGATGG + Intronic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098072273 12:66688804-66688826 AGGGTTGTTTCCTCCTTTGAAGG - Intronic
1103660837 12:122515134-122515156 TGCTGTGTTTCTGCCTCTGAAGG + Exonic
1104297276 12:127528233-127528255 TGTGTTGTTTCATCCACTGTGGG - Intergenic
1104324993 12:127787225-127787247 TGTGTTTTCTCAGCCTCTGGGGG + Intergenic
1107030538 13:35848390-35848412 TGTGCTGTTTCAATCTCTGAGGG + Intronic
1110423958 13:75344182-75344204 TATGTTGTCTAAGCCTCTGAAGG - Intronic
1111327189 13:86714375-86714397 TGGCTTGTTGCAGCATCAGACGG + Intergenic
1111701860 13:91700053-91700075 TGTGATATTTCAGCCTCTGCTGG + Intronic
1111886578 13:94029005-94029027 TGGCATTTGTCAGCCTCTGAGGG + Intronic
1112016771 13:95337663-95337685 TGGGTTGTTTGGGCTTCTCAGGG + Intergenic
1113557285 13:111248186-111248208 TTTGTTGTTTCAGCATTTGAAGG + Intronic
1115110322 14:29813392-29813414 TGTGATGTTTCACCATCTGATGG - Intronic
1119783954 14:77298583-77298605 TGGGTTATTTTAGCCTGTGATGG - Intronic
1120074675 14:80141898-80141920 TTGCCTCTTTCAGCCTCTGATGG - Intergenic
1120256006 14:82120550-82120572 TGGGTTAACTCAGTCTCTGATGG - Intergenic
1122133671 14:99620478-99620500 TGGCTGGATCCAGCCTCTGAGGG + Intergenic
1123939206 15:25208663-25208685 AGGGTTTTTTCAGCCCCTGCAGG + Intergenic
1124405914 15:29391317-29391339 TGTGTTGGTGCAGCCCCTGAAGG - Intronic
1127343527 15:58070003-58070025 GGGGCTGTTTCAGCCTCAGGTGG + Intronic
1129674721 15:77626278-77626300 TGGGTTATTTCTGCCTCAAAAGG + Intronic
1131474438 15:92725125-92725147 TGGGTCTTTTCTGCCTCTGCTGG + Intronic
1134504293 16:14792447-14792469 GGAGTTGTCTCAGCCTGTGAAGG + Intronic
1134576280 16:15336462-15336484 GGAGTTGTCTCAGCCTGTGAAGG - Intergenic
1134693544 16:16206607-16206629 TCGGTTGTTTCAGAAGCTGACGG + Intronic
1134726162 16:16420040-16420062 GGAGTTGTCTCAGCCTGTGAAGG + Intergenic
1134841540 16:17405700-17405722 GAGGTTGTCTCAGCCTCTGCAGG - Intronic
1134941272 16:18291820-18291842 GGAGTTGTCTCAGCCTGTGAAGG - Intergenic
1134978307 16:18588093-18588115 TCGGTTGTTTCAGAAGCTGACGG - Intergenic
1137734340 16:50712883-50712905 TGGGGTGTTAAAGTCTCTGATGG - Intronic
1138260325 16:55615582-55615604 TGCTTTGGCTCAGCCTCTGAGGG - Intergenic
1138621341 16:58213503-58213525 TGGATTGTTTCATAATCTGAGGG + Intergenic
1141468353 16:84221901-84221923 TGGGATGTTAAAGCCTCTGCTGG + Exonic
1141761365 16:86030768-86030790 TGGTTTGCTTCAGCTCCTGATGG + Intergenic
1146184197 17:30714427-30714449 AGGGTATTTTTAGCCTCTGAGGG - Intergenic
1146662799 17:34675841-34675863 TGGGTAGAGTCAGCCTCAGAGGG - Intergenic
1150216655 17:63475250-63475272 GGGGCTCTGTCAGCCTCTGAAGG - Intergenic
1151979863 17:77502365-77502387 GGGGTTGTCTCAGCCTCTCTGGG + Intergenic
1153525821 18:5993712-5993734 TTGGTTATTTCAGCCTATGTAGG + Intronic
1154124975 18:11683965-11683987 TGGCCTCTTTCAGCCTCTGGTGG - Intergenic
1155155950 18:23157538-23157560 TGGAATATTTCAGGCTCTGAAGG + Intronic
1158896805 18:61921918-61921940 TTGTCTGTTTCAGCATCTGACGG - Intergenic
1159231580 18:65613828-65613850 TGAATTGTAGCAGCCTCTGATGG + Intergenic
1160030596 18:75255224-75255246 TGTGTTGTTTCAGCATATGTGGG + Intronic
1161328282 19:3673694-3673716 TGGGTTGTTCCAGCGAATGAGGG - Intronic
1162814001 19:13182197-13182219 TGGGCTGTTTGAGGCTTTGAAGG + Intergenic
1162974578 19:14201251-14201273 AGGGTATTTTTAGCCTCTGAGGG + Intronic
1164483334 19:28632980-28633002 AGGGTTCTATCAGCCTCTCAGGG + Intergenic
1168260946 19:55194166-55194188 TGGGTGCTCTCAGGCTCTGATGG + Intronic
929931301 2:46257765-46257787 TGGGTTAATTCAGCTACTGAGGG - Intergenic
931940953 2:67252006-67252028 TGGCTTGTTTGAGCCCCTGAGGG + Intergenic
934577478 2:95412181-95412203 GAGGATGTTTCAGACTCTGAAGG - Intronic
937688633 2:124726695-124726717 TGAGTTGTTTCAGTTTCTTATGG + Intronic
939575781 2:143893144-143893166 AGGGTTTCTTGAGCCTCTGAGGG - Intergenic
940501007 2:154493771-154493793 TTGTTTCTTTCATCCTCTGAGGG - Intergenic
942530556 2:176905289-176905311 TGGGTTCTTTCTGCCTTTCAGGG + Intergenic
943177148 2:184490983-184491005 TGTGTTGCTTAAGCCTCTAATGG + Intergenic
946353003 2:219167998-219168020 TGGATTGTTTCTGCCTTTGTGGG - Exonic
1169660882 20:7976989-7977011 TCCATTGTTTCAGTCTCTGAGGG + Intergenic
1172694516 20:36812937-36812959 TGGGTGGTTCAAGCCTCTTAGGG - Intronic
1173241057 20:41297589-41297611 AGGGTTGTGTTAGCCTCGGATGG + Intronic
1173534067 20:43795370-43795392 TGGGGTGTATCGGCTTCTGAAGG + Intergenic
1173586476 20:44186846-44186868 GGGGCTCTTTCAGCCTCTGCTGG - Exonic
1174589557 20:51634519-51634541 TAGGTTCTTTCAGACTCTGCAGG - Intronic
1175542070 20:59754259-59754281 TCGGCTGCTGCAGCCTCTGAGGG - Intronic
1176240104 20:64071990-64072012 TGGGGTGTCTCAGCCTCTGTGGG + Intronic
1176276319 20:64271867-64271889 GGAGTTGTTTCAGCCTCTTGGGG + Intronic
1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG + Intergenic
1178777873 21:35569368-35569390 TCTGTTGTTTAAGCCTCTCAGGG + Intronic
1179856866 21:44166396-44166418 GGGTTTGGTGCAGCCTCTGATGG - Intergenic
1184612376 22:45613013-45613035 TGTGCTGTTTCTGGCTCTGAGGG - Intergenic
1185161863 22:49234773-49234795 TGGGCAGTGTCAGCCTCTGCTGG - Intergenic
952047542 3:29341615-29341637 TGCAATGTTCCAGCCTCTGATGG - Intronic
955043327 3:55337149-55337171 AGGATGGTTTCAGCCTCTTAGGG - Intergenic
955796382 3:62641622-62641644 TAGGTTGTTTTTGCTTCTGATGG - Intronic
957621447 3:82597624-82597646 TTGGTTGTTTCAAACTGTGATGG - Intergenic
959027659 3:101259197-101259219 TGGGTTCTTACTGCCTATGATGG - Intronic
959355277 3:105319565-105319587 TGGGGCTTTTCAGACTCTGAGGG + Intergenic
961749524 3:129087156-129087178 TGGGTTGTTCCTGCCACTGTGGG + Intergenic
962098392 3:132315926-132315948 TGTATTGTTTTAGCCTATGATGG + Intergenic
962449265 3:135498337-135498359 TAAGTAGTTTCAGCCTCTCAAGG + Intergenic
967202895 3:187089622-187089644 AGGATTGTTTCAGCTTCTCATGG + Intergenic
968832908 4:2942473-2942495 TGGGTTGTGCCAGACACTGAGGG + Intronic
969358917 4:6648870-6648892 TGGGGTTGTTCAGCCCCTGAAGG + Intergenic
970228389 4:13883366-13883388 TGGCTTGTTTCTGCTTCTCATGG + Intergenic
973590923 4:52440773-52440795 TGGGTGGTTTCAGCCTCACCTGG - Intergenic
974599591 4:64060187-64060209 TGGGTTGTTTCTGGCTCCCAAGG + Intergenic
975071043 4:70138774-70138796 AGAGATGTTTCTGCCTCTGAAGG + Intronic
979518979 4:121644030-121644052 TTGTTTGTTGGAGCCTCTGAAGG - Intergenic
982091365 4:151882839-151882861 TGGGTTGTTATTGCCTCTCAGGG - Intergenic
984696936 4:182788336-182788358 TGGGTTGTGTATGCCTCGGATGG + Intronic
985816198 5:2130085-2130107 TGGGCTGTCGCAGCCTCTGCAGG - Intergenic
987017683 5:13836970-13836992 AGGGCTGTTCCAGCCTCTGAAGG - Intronic
988514913 5:31895881-31895903 TGCCATGTTTCAGCCTCTGTTGG + Intronic
989507311 5:42242386-42242408 TTGGTGGTTTCAGTCTCTGAGGG + Intergenic
989779018 5:45242800-45242822 GGGGTTGTTTGATCTTCTGAAGG + Intergenic
990895244 5:60692737-60692759 TGGGTTGTTTCTGCCTATTATGG - Intronic
993407164 5:87526040-87526062 AGGGTTGTAGCAGTCTCTGATGG - Intergenic
997579299 5:135007217-135007239 TTGCTTCTTTGAGCCTCTGACGG + Intronic
998172790 5:139882295-139882317 TGGGCTGTCTCCACCTCTGATGG + Intronic
999049751 5:148509716-148509738 TGGGTTGCTTCTGCCTCTGCTGG - Exonic
999145820 5:149392872-149392894 GTGGTTGTTTCAGCCTTAGAGGG - Intronic
1000806030 5:165793692-165793714 TGAATTCTCTCAGCCTCTGATGG + Intergenic
1004743172 6:18483227-18483249 TGCCTTGTTTCAGCTTCTGTTGG + Intergenic
1006166886 6:32070470-32070492 TGGGTTTTTCCAGCCCCAGAGGG - Intronic
1006236707 6:32639676-32639698 TGTATTGTTTCAGCCTCTGCTGG - Intronic
1011034245 6:82956197-82956219 TGGGTTGTTTCTACTTCTGAAGG - Intronic
1011696824 6:89920621-89920643 TGGGTTGAGTCAGACGCTGAGGG - Intergenic
1011751465 6:90459089-90459111 TGGGTGGAGGCAGCCTCTGAGGG + Intergenic
1014583831 6:123172600-123172622 TGTGTTGTTTGATTCTCTGAAGG + Intergenic
1016253533 6:142075984-142076006 TGGGCTGTTTCATCTTCTGTTGG - Exonic
1019438250 7:1032656-1032678 CGGGTGGCTGCAGCCTCTGAGGG - Intronic
1020820283 7:12958555-12958577 TGGGGTGATTCAGGCTTTGAGGG - Intergenic
1022995526 7:35751291-35751313 TGGCTTGTATAAGCCTCTAAAGG - Intergenic
1023833727 7:44056573-44056595 TGGTTTGTTTGAGCCCTTGAGGG + Intronic
1024096491 7:45986851-45986873 GGGCTTCTTTCATCCTCTGATGG - Intergenic
1024532570 7:50405915-50405937 TGGGTTGTTTCAAACTCAGGGGG - Intergenic
1026987713 7:74565115-74565137 TGGGTTGTCTCAGCCCCTTGCGG - Intronic
1027866000 7:83648086-83648108 TTGGTGGATTCAGCCTCTCAAGG + Intronic
1029873528 7:103722159-103722181 TGCCTTGTTTCAGCCTGTGTAGG - Intronic
1030337965 7:108345961-108345983 TGGGCTGTAGGAGCCTCTGATGG + Intronic
1031238393 7:119207343-119207365 TGTCTTGTTTCAGCTTCTAAAGG - Intergenic
1031456134 7:121981653-121981675 TGGATTGTTTCAGGGTTTGAAGG + Intronic
1031681260 7:124677670-124677692 TGTGTTGTTTCAGTTTTTGATGG + Intergenic
1031923065 7:127615303-127615325 GGGGCTGTTGCAGGCTCTGAGGG - Intronic
1032757094 7:134901536-134901558 TGAGTTGTATTAGCTTCTGAGGG + Intronic
1034587618 7:152109309-152109331 TATGTTCTTTCAGCCTTTGAAGG + Intronic
1034783965 7:153908294-153908316 TCTGTTGTTTCATCCTCTGTGGG - Intronic
1035096218 7:156357982-156358004 AGGGTTGTATCAGCATTTGAGGG - Intergenic
1035925206 8:3720762-3720784 TGGATCGTGTCAGCATCTGAAGG - Intronic
1040561161 8:48524423-48524445 TGGGGTGTTACAGCCTCCTAAGG + Intergenic
1041179725 8:55235073-55235095 TTGGTTGCTGGAGCCTCTGAGGG + Intronic
1041276511 8:56165260-56165282 TGGATTGACTCAGCCTCTGTGGG - Exonic
1042616234 8:70653197-70653219 AGGATTGTTTGAGCCTGTGAGGG - Intronic
1045084859 8:98671308-98671330 TGGGTTTTTTCCCCCTCAGATGG - Intronic
1045431983 8:102123512-102123534 TGGGTTGTATCAGCCCGGGAGGG - Intronic
1049908533 9:243146-243168 TGAGTTGATTAAGCCCCTGAAGG - Intronic
1053100827 9:35370988-35371010 TGGGTTGTTTGTGCCTCAGAAGG - Intronic
1060222418 9:121771799-121771821 TGGGTTGGCTTAGCCTCAGACGG - Intronic
1061238899 9:129357930-129357952 TGTGATGTTTCTGCCTCTCAGGG + Intergenic
1203561841 Un_KI270744v1:64241-64263 TGGCTTCTCTCAGCCTCCGATGG + Intergenic
1189231500 X:39455664-39455686 TTGGCTGTTGCAGCCTCAGAGGG - Intergenic
1190627542 X:52351409-52351431 TGGGCTATTTCAGCCTCAGTAGG + Intergenic
1192433743 X:71129588-71129610 TGGGGTGTTTCTACCTCTGTGGG + Intronic
1197054260 X:122097854-122097876 TGGCCTGTTTTAGCCACTGATGG - Intergenic