ID: 1097158581

View in Genome Browser
Species Human (GRCh38)
Location 12:57029804-57029826
Sequence CCCAAGCTGCAGAAGCTGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097158581_1097158591 20 Left 1097158581 12:57029804-57029826 CCTTTCAGCTTCTGCAGCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 229
Right 1097158591 12:57029847-57029869 AGTCACCACAGAATGGAATGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1097158581_1097158590 19 Left 1097158581 12:57029804-57029826 CCTTTCAGCTTCTGCAGCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 229
Right 1097158590 12:57029846-57029868 TAGTCACCACAGAATGGAATGGG 0: 1
1: 0
2: 1
3: 21
4: 169
1097158581_1097158589 18 Left 1097158581 12:57029804-57029826 CCTTTCAGCTTCTGCAGCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 229
Right 1097158589 12:57029845-57029867 GTAGTCACCACAGAATGGAATGG 0: 1
1: 0
2: 1
3: 19
4: 221
1097158581_1097158588 13 Left 1097158581 12:57029804-57029826 CCTTTCAGCTTCTGCAGCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 229
Right 1097158588 12:57029840-57029862 CCAATGTAGTCACCACAGAATGG 0: 1
1: 0
2: 2
3: 10
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097158581 Original CRISPR CCCAAGCTGCAGAAGCTGAA AGG (reversed) Exonic
900534975 1:3172277-3172299 CCCAAGGTACAGAGGCTGGAAGG + Intronic
902146773 1:14408324-14408346 CCAAAGCTACAGATGCTCAAAGG - Intergenic
904794022 1:33045325-33045347 GCCACCCTGCAGAAGCTGAAAGG + Intronic
904826427 1:33276501-33276523 CCCAAGCTGCAGCAGGTGCCGGG + Exonic
904999565 1:34657665-34657687 CCCAGAGTGCAGAGGCTGAAGGG + Intergenic
905454373 1:38077693-38077715 CCCAATCTGAAGAAGGTGATGGG - Intergenic
906194215 1:43920030-43920052 CCCTATCTGCAGCAGCTGAGGGG - Intronic
912285923 1:108369043-108369065 CCCACCCTGCAGAAGATGAAAGG - Intergenic
912738667 1:112173689-112173711 GCCAAGCTGCTGAAGCAGAGTGG - Intergenic
914509539 1:148318712-148318734 CGCAAGCCACAGGAGCTGAAGGG - Intergenic
915196124 1:154191271-154191293 GCCATGCAGAAGAAGCTGAAAGG - Exonic
915471585 1:156128961-156128983 CCGAAGCTGAAGCAGCTGCAGGG - Intronic
917379605 1:174390884-174390906 CCCAAGTTCTAGAAGCTCAAAGG - Intronic
918265074 1:182834491-182834513 CCCAACATGCAGAGGCTGAGAGG - Intergenic
919731441 1:200916021-200916043 CTCAAGCTGAAGAGGCTGTAAGG - Intergenic
922291534 1:224212825-224212847 CCCAGGTTGAAGAAGATGAAAGG - Intergenic
922738881 1:228004876-228004898 CCCAGGCTGCAGAAGATGAAGGG - Intergenic
922918567 1:229279465-229279487 CCCAAACTGCAGTAGATCAAAGG - Intronic
1064201196 10:13286336-13286358 TCCAAGCATCAGCAGCTGAATGG + Intronic
1066362440 10:34744403-34744425 TCCAAGATGAAAAAGCTGAAAGG + Intronic
1066757193 10:38722878-38722900 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1067807715 10:49404643-49404665 CCCAAGCTGCCGGGGCTGAGGGG - Intergenic
1068991821 10:63158566-63158588 CCCAGGCAGCAAAACCTGAAAGG - Intergenic
1069849043 10:71393262-71393284 CACAGGCAGCAGAAGCAGAAGGG - Intergenic
1071490103 10:86130465-86130487 CCCAGGCTCCATAAGCAGAAGGG + Intronic
1071831350 10:89375389-89375411 CCCAAGCTGCAGAGCAAGAAAGG + Intronic
1073475087 10:103747402-103747424 CCGAGGCTGCACAGGCTGAATGG - Intronic
1074866933 10:117550011-117550033 CCCAATCTGCTGAAGGTGATGGG + Intergenic
1076441092 10:130481846-130481868 TCCCAGCTGGAGAAGCAGAATGG + Intergenic
1077506631 11:2932578-2932600 CCCAAGCTGCAGATGCAGAAAGG + Intergenic
1078319640 11:10322641-10322663 CCCAAGCTGCAGCAGCTGTGGGG + Intronic
1078909566 11:15718299-15718321 CCCCAGCTCCAGGAGCTGCAGGG + Intergenic
1079019125 11:16894637-16894659 CCCAAAATGAAGAAGGTGAATGG + Intronic
1080274630 11:30489866-30489888 GCCAAGCTGCAGAAAGTGAAAGG - Intronic
1080652920 11:34236825-34236847 CCCAAGCTGCAGAGGCTGTCTGG - Intronic
1083600772 11:63946287-63946309 CCCAGGCGGCAGAGGCTGCAAGG - Intronic
1084948251 11:72650601-72650623 TCCAGGCTGCAGAACCTGGAGGG + Intronic
1087563058 11:99815906-99815928 TGCAAGGTGCAGAAACTGAAAGG - Intronic
1088894139 11:114065009-114065031 CCCAAGCTGCAGAAAGGGACAGG - Intronic
1090548575 11:127792890-127792912 CCCAAGTTGCAGAAGCTTTTTGG + Intergenic
1096210441 12:49761250-49761272 CCCAAGCTGCAGTAGGAGAGTGG + Intronic
1097158581 12:57029804-57029826 CCCAAGCTGCAGAAGCTGAAAGG - Exonic
1100744401 12:97629543-97629565 CTCATGCTGCAGATGCTGATGGG + Intergenic
1102052323 12:109871835-109871857 CCCATGCTGCAGAAGCCCATTGG + Intronic
1102218845 12:111180694-111180716 CCACAGCTGCAGGAGCTGAGAGG - Intronic
1103717239 12:122952022-122952044 CTCACGCTGCAGAAGGTGGAAGG - Intronic
1107533738 13:41308649-41308671 CCCAAGCTGCCCAAGCTGTTAGG - Intergenic
1108639694 13:52371445-52371467 CCCAAGCTGATGAAGAGGAATGG + Intergenic
1110305944 13:73986765-73986787 CCAAAGCTGCTGGAGTTGAATGG + Intronic
1111783840 13:92763350-92763372 CCAAAGCTGAAGAAGCTGAATGG - Intronic
1112708526 13:102100264-102100286 CCCAATCTGCAGATCTTGAAAGG - Intronic
1113559689 13:111268673-111268695 CCAAGGCTGCAGAGCCTGAAGGG - Intronic
1113600941 13:111567776-111567798 CCCAAGCCGGAGTTGCTGAACGG - Intergenic
1114678089 14:24458988-24459010 CCCAAGCTGAAGAAGCAGCCAGG - Intergenic
1114976121 14:28102143-28102165 CACCAGCTGCAGAAGCAGGATGG - Intergenic
1115727955 14:36237784-36237806 TCCAAGTTGCAAAAGCTGAAAGG + Intergenic
1116639257 14:47440194-47440216 AGCAGGCTGCAGCAGCTGAAGGG - Intronic
1116855846 14:49951646-49951668 CCAAAGCTGGAGAAGCAGCAAGG + Intergenic
1119315323 14:73689494-73689516 CCCAAACTGAAAAAGCTGGATGG + Exonic
1119468889 14:74881568-74881590 CCCAAGGTACAGAGGCGGAACGG + Intergenic
1119566225 14:75631437-75631459 CCCATACTGCTGAAGCTGAGTGG - Intronic
1125818824 15:42610219-42610241 TCCTAGCAGCAGAAGATGAAGGG - Intronic
1130320237 15:82835498-82835520 CCCAGGCTGCAGCTGCTGAAAGG - Exonic
1133076616 16:3285176-3285198 CCCAGGCTGCAGGAGCTGCTAGG + Exonic
1133080638 16:3316591-3316613 ACCAAGCTCCAGAAGTTGCAGGG - Intronic
1134688602 16:16175850-16175872 CTGAAGCTGAAGTAGCTGAAGGG - Intronic
1136080571 16:27849946-27849968 GCCAAGATGAAGAAGATGAAGGG + Intronic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1136720335 16:32314847-32314869 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1136725388 16:32353239-32353261 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1136838712 16:33521123-33521145 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1136843722 16:33559297-33559319 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1138912739 16:61421946-61421968 CCCAGGATGCTGAGGCTGAAGGG + Intergenic
1139390106 16:66601905-66601927 CCCAAACTGCAGCTGCAGAATGG - Intergenic
1141696953 16:85624686-85624708 CCCAGCCTACAGAGGCTGAACGG - Intronic
1141843867 16:86593707-86593729 CCCAGGCTGCTGTAGCTGCACGG + Intergenic
1203001043 16_KI270728v1_random:164515-164537 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1203006096 16_KI270728v1_random:202922-202944 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1203132645 16_KI270728v1_random:1700919-1700941 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1203148877 16_KI270728v1_random:1821409-1821431 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1203153887 16_KI270728v1_random:1859595-1859617 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1142591954 17:1010154-1010176 CCCACGCTCCAGCAGCAGAAGGG - Intronic
1142680063 17:1542122-1542144 CCCAGGAGGCAGAAGCTGCAGGG + Intronic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1145763857 17:27444395-27444417 CCCAAGCCGCAGTTCCTGAAGGG - Intergenic
1145814920 17:27788752-27788774 CCCAAGCTGGTGAAGCTGCCAGG - Intronic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146375298 17:32289750-32289772 CCCCAGCTGCAGCTCCTGAATGG + Intronic
1147740952 17:42670700-42670722 GCCAAGCTGCAGAAGAGGAGCGG + Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1149144251 17:53470789-53470811 CCAATGCTGCAGAATCAGAAGGG - Intergenic
1150671010 17:67197279-67197301 CACAATCAGCAGAAGGTGAAAGG - Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151383498 17:73741395-73741417 GCCAAGCCGCTGAAGGTGAAGGG - Intergenic
1152702354 17:81825363-81825385 CCCAAGGTGGGGAAGCTGACAGG + Exonic
1154145637 18:11864160-11864182 CCCAAGAGGCAGAAGTTGCAGGG - Intronic
1156273865 18:35562577-35562599 CCCAAAGTGCAGAATCTAAAAGG + Intergenic
1156549346 18:37999170-37999192 CCCCGGCTGCAGAACCTGAGAGG + Intergenic
1161417169 19:4153828-4153850 CCCAAGCTGCCAGAGCTGGAAGG + Intronic
1162961243 19:14128169-14128191 CCCCAGCTGCTAGAGCTGAAGGG - Intronic
1162967080 19:14161115-14161137 CCCCACCTGCAGAACCTGCAGGG - Intronic
1165004188 19:32790958-32790980 TCTCAGTTGCAGAAGCTGAAGGG + Intronic
1165229795 19:34379734-34379756 TCAAAGCTGCAGAGGTTGAATGG - Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1168653276 19:58107483-58107505 CCCAAGAGGCAGAGGCTGCAGGG + Intronic
925808415 2:7674749-7674771 CCCTTGCTGCAGAAGCTCAAGGG - Intergenic
926170374 2:10549420-10549442 CCCAAGTTCCAGCAGCTGCAAGG - Intergenic
927672284 2:25078879-25078901 CACAAGCTGGAGATGTTGAAGGG - Intronic
929969617 2:46562914-46562936 CCAAATCTGCTGAAACTGAATGG + Intronic
930459621 2:51656104-51656126 ACCAAGCAACAGAAGTTGAAGGG + Intergenic
934320499 2:91967319-91967341 CCACCACTGCAGAAGCTGAAGGG + Intergenic
934847242 2:97669718-97669740 CCACAGCTGCTGAATCTGAAGGG + Intergenic
936249157 2:110854168-110854190 CCCATGCTGCACAGCCTGAAGGG - Intronic
936475863 2:112839233-112839255 CCCAAGTCCCAGAAGCAGAATGG - Intergenic
937443006 2:121932884-121932906 CACAAGCTGCAGAGTCTGACTGG + Intergenic
939113650 2:138036504-138036526 CCCAGGTGGAAGAAGCTGAATGG - Intergenic
942555168 2:177165348-177165370 CCATGGCTGCAGAAGCTGTAGGG + Intergenic
943416615 2:187614711-187614733 GCCAACGTTCAGAAGCTGAAAGG + Intergenic
944545760 2:200797632-200797654 CGCAAGCTACACAAGCTAAAGGG + Intergenic
945256838 2:207810277-207810299 CCCAAGCTCCAGAGCATGAATGG - Intergenic
946719177 2:222585725-222585747 CACAAGCTTCAGTAGCTGATTGG + Intronic
947714815 2:232334152-232334174 CCGGTGCTGCAGAAGCTGCATGG + Intronic
948194967 2:236088360-236088382 CCCAAACTCCAGATGCTTAATGG - Intronic
948609846 2:239159812-239159834 CCCAGGCTGCAGGAAATGAAAGG - Intronic
948638530 2:239358036-239358058 CCCAAGCTACCGAAGCTCACTGG + Intronic
1169831019 20:9824924-9824946 CTCAAGGTGCAGCTGCTGAATGG + Intronic
1169889319 20:10435315-10435337 GCCAACCTTCAGAAGCTTAAGGG - Exonic
1170847660 20:19975508-19975530 TCCCAGCTGCAGAAGGTGAGCGG + Exonic
1171152194 20:22837132-22837154 CCCATGTGGCAGAGGCTGAAGGG - Intergenic
1171296760 20:24023865-24023887 CCCATGCTGGAGAGGCTGAGGGG - Intergenic
1173248604 20:41352755-41352777 ATCAAGCTGCAGCAGCTGCAGGG - Intronic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1173580493 20:44143447-44143469 CCCAAGCGGCAGAGGGTGAAGGG - Intronic
1173970492 20:47148590-47148612 CCCAAGCTGCAGCAGTTGGCTGG - Intronic
1174205083 20:48832328-48832350 CTCAGCCTGCAGAAGCTGACAGG - Intergenic
1174505771 20:51016517-51016539 CCTAAGCTGAAGAGGCAGAAGGG + Intronic
1175419829 20:58824235-58824257 CCAGAGCAGCAGAAGCTGACGGG + Intergenic
1176150651 20:63589087-63589109 GCCAAGCAGCCCAAGCTGAAGGG + Exonic
1176229886 20:64027078-64027100 CCCAAGCTGTGGATGATGAAGGG + Exonic
1177553797 21:22662315-22662337 CACATGATGCAGAAGCAGAAGGG + Intergenic
1178672753 21:34606275-34606297 GCCAAGCGGCAGAGGCTGGAAGG - Intronic
1179022551 21:37653418-37653440 GCCAGGCTGCAGAAGCAGATGGG + Intronic
1180308744 22:11151378-11151400 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1180547221 22:16513189-16513211 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1180937839 22:19637755-19637777 CCCACGGTGCAGATGCTGCATGG - Intergenic
1181913377 22:26258370-26258392 CCCCAGCTGCAGAATCCAAAAGG + Intronic
1182211945 22:28684146-28684168 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1183037982 22:35154661-35154683 GCCAAGGTGCAGAGGCAGAATGG + Intergenic
1183361737 22:37386456-37386478 CTGAAGCGACAGAAGCTGAATGG - Intronic
1183984709 22:41563042-41563064 CCCAAGCCACAGAAGCCCAAAGG + Intronic
1183988869 22:41584753-41584775 ACCAAGCTGCAGAGGGAGAAAGG - Intronic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950298352 3:11851440-11851462 CCCAGGCTGCAGATGAGGAAAGG - Intergenic
951418278 3:22451424-22451446 CCACAGCAGCAGAAGCTCAAAGG + Intergenic
951620610 3:24597945-24597967 CCCAAGGTCCTGAAGCTGGATGG - Intergenic
953553260 3:43921570-43921592 CCAAAACTGCAGAAGTTGTAGGG - Intergenic
953913052 3:46902424-46902446 CCCAGGCTCCGGAAGCTCAAAGG - Intronic
954330040 3:49884960-49884982 CATGAGCTGCAGAAGCTCAATGG + Intergenic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
961457083 3:127029607-127029629 CCCACGCTGCAGCAGCCGGACGG + Intronic
962149792 3:132880682-132880704 CCAAAGTTGCAGAGGCAGAAGGG + Intergenic
963101424 3:141609502-141609524 CTTAAGCTGCAGAAGATGGAAGG + Exonic
968027665 3:195456151-195456173 CTCAAGGTTCAGGAGCTGAAAGG + Intergenic
968706856 4:2082759-2082781 ACAAAGCAGCAGAAGCTGAAAGG - Intronic
968731120 4:2269859-2269881 CCCAAGCTGCCGCAGCTGAGTGG - Exonic
969156316 4:5213466-5213488 TCTAAGCTGGAGAAGCTAAAAGG - Intronic
970641856 4:18075646-18075668 CCATGGCTGCACAAGCTGAAAGG - Intergenic
970929554 4:21493583-21493605 TCCAAGCAGCAGAAACTCAAAGG - Intronic
971090420 4:23337204-23337226 CCCAAATTGCAGAAACTGAGAGG + Intergenic
972581349 4:40398270-40398292 AGGAAGCTGCAGAAGCTGAGGGG - Intergenic
974746308 4:66082459-66082481 CCCAAGCTGGAGAAGGAGGAAGG + Intergenic
977929811 4:102738080-102738102 CACTAGCTGCAGTAGCAGAAGGG - Intronic
978369421 4:108015635-108015657 CCCAAGCTTCAGAAGCAAACTGG - Intronic
979934195 4:126671095-126671117 CACAAGCTTCAGTAGCTGATTGG + Intergenic
980586055 4:134817296-134817318 CCAAAGCTGAAGCAGCTGAGAGG + Intergenic
981831739 4:149009635-149009657 GCTATGCTACAGAAGCTGAAAGG - Intergenic
984375639 4:178925327-178925349 CACATACTCCAGAAGCTGAAGGG + Intergenic
985878630 5:2620070-2620092 CCCAAGCCTGAGAAGCTGCAGGG - Intergenic
987291473 5:16512350-16512372 CACATGCTGCAGAAGCCCAAGGG + Intronic
987364487 5:17136938-17136960 CCCAAGATGCACAGGCAGAAAGG + Intronic
988496236 5:31748556-31748578 CCCCAGCAGCAGAAGCTGTGGGG + Intronic
989255583 5:39362916-39362938 CCCCAGCTCCAGCAGCTGCACGG - Intronic
990902595 5:60769525-60769547 CCAAATCTGAAGAAGTTGAAAGG - Intronic
991381754 5:66035357-66035379 ACCAAGCTAAAGAAGCTGAGGGG - Intronic
991419864 5:66429803-66429825 CCCCTGTTGCAGAAGCTAAAGGG + Intergenic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
991668086 5:69020031-69020053 GACAAGCTCCAGAGGCTGAATGG + Intergenic
992955820 5:81907119-81907141 ACCCAGCTGCAGGAGCTGAAAGG + Intergenic
993305975 5:86275808-86275830 CCCACCCTGCAGAAGATGAAAGG - Intergenic
994941328 5:106327500-106327522 CCAAAGTTGCAGAGGCAGAATGG - Intergenic
996360538 5:122640432-122640454 CCATAGCTGCAGTAACTGAAGGG + Intergenic
997375865 5:133396948-133396970 CGCAGGCTGAGGAAGCTGAAGGG + Intronic
998817498 5:146028913-146028935 TCCTAGCTGGAGAAGCTGAAAGG + Intronic
1000087701 5:157902544-157902566 CCTAAGGTGCTGAAGTTGAAAGG - Intergenic
1001040954 5:168334855-168334877 GCCCAGCTGAAGAAGCTGATTGG + Intronic
1002802158 6:533797-533819 CCAGTGCTGCAGAAGCAGAACGG - Intronic
1004314909 6:14577944-14577966 GCCAAGCTGCAGAATATCAATGG - Intergenic
1005989279 6:30893142-30893164 CCCAAGCTGCTGAAGTTGGTGGG - Exonic
1008041732 6:46808740-46808762 CCCAAGCAGCAGAAGCCTAATGG - Intronic
1010672641 6:78704632-78704654 CCAAAGATGCAGAAACTGACAGG - Intergenic
1012422629 6:99081319-99081341 TGCAAGCTGCAGAACCTGAGAGG + Intergenic
1016314693 6:142772529-142772551 CCCAAACTGCAGATGCAGGAAGG - Exonic
1019753564 7:2750281-2750303 CCCAAACTGCAGAGGCAGACAGG + Intronic
1020003979 7:4771934-4771956 CCCCTGCTCCAGAGGCTGAAGGG + Intronic
1020469211 7:8516850-8516872 CCCAGGGTGCAGAAGGTGGATGG + Intronic
1022041554 7:26586617-26586639 CCCTGGCCGCTGAAGCTGAAAGG + Intergenic
1022477582 7:30721914-30721936 CCCAGGATGTTGAAGCTGAAGGG - Intronic
1022935900 7:35176077-35176099 CCCAAGAGGCAGAGGCTGCAGGG + Intergenic
1032119527 7:129145741-129145763 CCCAAGCAGAAGATTCTGAAAGG - Intronic
1032383391 7:131505776-131505798 CCCGAGTTGCAGAAGAGGAAAGG - Intronic
1032997270 7:137461677-137461699 ATCCAGCTGGAGAAGCTGAAAGG + Intronic
1034222428 7:149456844-149456866 CCCCTGCTGTAGAGGCTGAACGG + Intronic
1034274643 7:149818680-149818702 CCCCTGCTCCAGAAGCTGCACGG + Intergenic
1034450960 7:151137122-151137144 ACCAGGCTGCAGCAGCTGGAAGG - Intronic
1041965500 8:63670291-63670313 CCCAGGCTGCTGATGCCGAAGGG + Intergenic
1043439907 8:80267799-80267821 CCCTAGCTGCAGATGCCAAAGGG - Intergenic
1044771719 8:95642717-95642739 CCCTAGGTGCTGAAGATGAAAGG + Intergenic
1045270783 8:100659309-100659331 CCCAGGCTGGAGAGGCTGGAGGG - Intronic
1048243161 8:132764603-132764625 GCAAAGCTAGAGAAGCTGAAAGG - Intergenic
1049322086 8:142001964-142001986 CCCGCGTTGCAGAAGCTGCAGGG - Intergenic
1049341978 8:142118087-142118109 GCCAGGCTCCAGAAGCTGGAAGG + Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1049675974 8:143889320-143889342 GCCAAGCAGCAGGAGCTGCAGGG - Intergenic
1049779835 8:144423905-144423927 CCCAGGCTGCAGACCCTGAGCGG - Exonic
1050152852 9:2634315-2634337 CCACAGCTGCAAATGCTGAAAGG + Intronic
1051864281 9:21661895-21661917 CCCTACCTGCAGCACCTGAAGGG + Intergenic
1053238920 9:36480427-36480449 TCCAAGGTGCAGAAGCAGAATGG + Intronic
1056924957 9:90826602-90826624 CCAGAGCTGTAGAAGCTGGAAGG - Intronic
1057353154 9:94316901-94316923 GCCCAGCAGCAGAAGCTGATGGG - Intergenic
1057654593 9:96940690-96940712 GCCCAGCAGCAGAAGCTGATGGG + Intronic
1058760133 9:108122541-108122563 GCCAAGCAGCAGCAGCTCAAGGG - Intergenic
1058849091 9:108993236-108993258 GCCAATCTCCACAAGCTGAACGG + Intronic
1059419883 9:114184242-114184264 ACCCAGCTGCAGAGGTTGAATGG + Intronic
1061155776 9:128860471-128860493 CCCAAACTGGAGAGGCAGAAAGG - Intronic
1061667334 9:132168279-132168301 GCCAGGCTGCAGAAGCTCACAGG + Intronic
1187469078 X:19552448-19552470 CCCAAGGAGCAGATGCTGACTGG + Intronic
1187658782 X:21513796-21513818 CCAAAACTGCAGAACCAGAAAGG - Intronic
1187870744 X:23763124-23763146 CCCAAGCTGCATAAACACAAAGG - Intronic
1189442766 X:41051957-41051979 CCCAGGCTGGAGAGGCTGGAGGG - Intergenic
1192189562 X:68982685-68982707 TCCCAGCTGCAGAAGATGAAGGG + Intergenic
1192282624 X:69701594-69701616 CGCAAGCTTCAGAAGCTTGACGG - Intronic
1192857161 X:75024575-75024597 CACAAGCTTCAGTAGCTGATTGG - Intergenic
1194076399 X:89399967-89399989 CTCAAGCTGCAGTAGCAGAAGGG + Intergenic
1194079385 X:89439718-89439740 GCAAAGCTGTAGCAGCTGAAGGG + Intergenic
1198786510 X:140294689-140294711 CCCAAGCTGAAGGAGCAGACTGG + Intergenic
1199542022 X:148967927-148967949 CCCCAACTTCAGAAGCTCAATGG + Intronic
1200182251 X:154157770-154157792 CTCAAGCAGCAGCTGCTGAATGG + Intronic
1200187905 X:154194884-154194906 CTCAAGCAGCAGCTGCTGAATGG + Intergenic
1200193555 X:154232024-154232046 CTCAAGCAGCAGCTGCTGAATGG + Intronic
1200199310 X:154269828-154269850 CTCAAGCAGCAGCTGCTGAATGG + Intronic
1200429039 Y:3055487-3055509 CTCAAGCTCCAGTAGCAGAAGGG + Intergenic