ID: 1097159458

View in Genome Browser
Species Human (GRCh38)
Location 12:57036119-57036141
Sequence TGCCCCCGAGTCCAAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097159452_1097159458 30 Left 1097159452 12:57036066-57036088 CCTGCCACAAGGTTGCCTGGATT 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 105
1097159455_1097159458 5 Left 1097159455 12:57036091-57036113 CCACTCATGCCAAAATGCTATCT 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 105
1097159453_1097159458 26 Left 1097159453 12:57036070-57036092 CCACAAGGTTGCCTGGATTGTCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 105
1097159454_1097159458 15 Left 1097159454 12:57036081-57036103 CCTGGATTGTCCACTCATGCCAA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 105
1097159456_1097159458 -4 Left 1097159456 12:57036100-57036122 CCAAAATGCTATCTGATTCTGCC 0: 1
1: 0
2: 2
3: 14
4: 277
Right 1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097159458 Original CRISPR TGCCCCCGAGTCCAAGGCAC TGG Intronic
900421575 1:2558080-2558102 TGCCCCCGAGCCCATGTCTCTGG - Intronic
900481924 1:2903554-2903576 TGCCCCAAGGTCCAAGGCCCTGG + Intergenic
902122636 1:14180481-14180503 TGTCACCAAGTCGAAGGCACTGG + Intergenic
902144982 1:14391151-14391173 TCCCCTGGAGTCCAATGCACTGG - Intergenic
902332815 1:15738892-15738914 AGCCCCCGGGTCCCAGGCACAGG + Intronic
903875564 1:26471394-26471416 TGCCCCCTAGTCCAAAGCCAGGG - Intergenic
905324393 1:37140539-37140561 TGACCCCTAGTCCAAGACCCTGG + Intergenic
910760749 1:90729119-90729141 GGCCCCGGAGTCCATGCCACGGG - Intergenic
911476981 1:98385850-98385872 GGCCCCCGAGATCAAGGCAAGGG - Intergenic
924025118 1:239824017-239824039 TGCTCCCGAGTCACAGCCACAGG - Intronic
1067449213 10:46371069-46371091 TGCCCCCGAGTCCAGGGTGAGGG - Intronic
1067588157 10:47489696-47489718 TGCCCCCGAGTCCAGGGTGAGGG + Intronic
1067873053 10:49979243-49979265 TGCCACCAAGTCCAAATCACTGG - Intergenic
1067878145 10:50021946-50021968 TGCCCCCGAGTCCAGGGTGAGGG - Intergenic
1069717675 10:70531397-70531419 GGACCCCGGGTCCAAGGCCCTGG - Exonic
1074114370 10:110444443-110444465 TGTCCACTAGTCCAAGGCAGAGG + Intergenic
1074722213 10:116272921-116272943 AGCGCCCGAGTCCTGGGCACCGG - Intronic
1079740737 11:24056440-24056462 TGCACCAGAGACCAAGACACAGG + Intergenic
1083952890 11:65966566-65966588 TGACCCCGAGTATAAGGCACGGG - Intronic
1084088418 11:66865313-66865335 TGCTCCAGAGTCCAAGGCAGAGG - Intronic
1089119710 11:116124989-116125011 TGCCCTCTACTCCAAGGAACAGG + Intergenic
1089388994 11:118087143-118087165 TTCCCTGGAGTCCAAGGCCCTGG - Intronic
1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG + Intronic
1097180641 12:57169811-57169833 GGCCCCAGAGGCCAGGGCACTGG - Intronic
1100415626 12:94370857-94370879 TGCCCCTTAGTCCCAGCCACTGG + Intronic
1104901376 12:132191082-132191104 AGTCCCAGAGTCCAAGGCCCAGG - Intergenic
1114049549 14:18912275-18912297 AGCCCCTGAGTCCAGGGCACAGG - Intergenic
1114113013 14:19489656-19489678 AGCCCCTGAGTCCAGGGCACAGG + Intergenic
1117718739 14:58607181-58607203 TGACCCCCAGTCCCAGGCTCCGG - Intergenic
1119516519 14:75252778-75252800 TGCCCCAGGGTCCAGGGCAAGGG + Intronic
1123931095 15:25172013-25172035 TGCCCTCCACTCCCAGGCACAGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1128072870 15:64808129-64808151 TGCCCCTGAGTCCTTGGCCCTGG - Intergenic
1129299186 15:74615720-74615742 AGCCCCCGACTCGAAGGCTCCGG - Exonic
1130041257 15:80406653-80406675 TCTCCCGCAGTCCAAGGCACAGG - Intronic
1131182374 15:90249514-90249536 TGCCCTCGTGTCCATGGCAACGG + Intergenic
1133343722 16:5056015-5056037 TGCCCCCGGGGCAAAGGAACAGG - Intronic
1133715163 16:8440750-8440772 TGCCCCCTAGTCCAACGCCTTGG + Intergenic
1136839171 16:33524450-33524472 TCTCCCCCAATCCAAGGCACTGG + Intergenic
1203149336 16_KI270728v1_random:1824737-1824759 TCTCCCCCAATCCAAGGCACTGG + Intergenic
1143020221 17:3913729-3913751 GGCCCCCGTGTCCCAGACACAGG - Intronic
1144855171 17:18263510-18263532 TGCCCCAGAGTCCAACACCCTGG - Intronic
1145236033 17:21209059-21209081 TGCCCCAGACTCAAAGGCACGGG + Intronic
1149681019 17:58507190-58507212 TGTCCCCGGGTCCAGGGCACAGG + Exonic
1152450327 17:80374547-80374569 TGTCCTCGAGTGCAAGCCACTGG + Exonic
1153107472 18:1544193-1544215 TGCCAGCCAGTCCAAGGCTCAGG + Intergenic
1157598031 18:48875586-48875608 GGCCCCCGAGACCCAGGCACCGG + Intergenic
1158609332 18:58924324-58924346 TGCCCCAGAGCCACAGGCACAGG - Intronic
1159304072 18:66616574-66616596 TGGCCCCAAGTCCACTGCACCGG - Intergenic
1160496807 18:79380738-79380760 AGCCCCCCAGTCCACTGCACAGG + Intergenic
1160829122 19:1094780-1094802 TGCCCCAGACCCCAAGGCACGGG + Intronic
1161630605 19:5353338-5353360 GGCCCCAGAGTGCCAGGCACAGG - Intergenic
1162760478 19:12885737-12885759 GGCCCCCGAGCCCAAGGCGCTGG - Exonic
1163284056 19:16335336-16335358 GGCCCCCAAGGCCAGGGCACCGG - Intergenic
1163579295 19:18128785-18128807 TGCCCCCAAGCCCAAACCACTGG - Intronic
1168588607 19:57614589-57614611 GGCCCCAGTGTCCAAGGCAGCGG + Intronic
926320116 2:11743622-11743644 TTCCCCGGAGCCCCAGGCACTGG + Intronic
926398251 2:12467988-12468010 TGCCTCTGGGTCCAAAGCACTGG + Intergenic
927857696 2:26537609-26537631 TGGCCCCAAATCCCAGGCACTGG - Intronic
930458227 2:51634120-51634142 TGCCCACTAGTGCAAGGTACAGG + Intergenic
933861708 2:86475920-86475942 TGTCTCAGAGTCCAAGGAACAGG + Intronic
936148012 2:109994652-109994674 TCTCCCCCAGTCCAAGGCACTGG + Intergenic
936196680 2:110376795-110376817 TCTCCCCCAGTCCAAGGCACTGG - Intergenic
938288673 2:130138183-130138205 AGCCCCTAAGTCCAGGGCACAGG + Intergenic
938426901 2:131200610-131200632 AGCCCCTGAGTGCAGGGCACAGG - Intronic
938467860 2:131534749-131534771 AGCCCCTAAGTCCAGGGCACAGG - Intergenic
945225579 2:207529389-207529411 CGCCCCCGGGTCCCAGGCCCCGG + Intergenic
945251358 2:207768646-207768668 GGCCGCCGCGTCCAAGGCCCCGG - Exonic
948408478 2:237740821-237740843 TGACCCCGAGGCCACGGCCCAGG + Intronic
1172031839 20:31987866-31987888 TGACCCACAGTCCAAGGGACAGG + Intronic
1173646176 20:44634433-44634455 TGCCCCCGAGTCCATGGCCCTGG - Intronic
1174726309 20:52865966-52865988 TTACCCCCAGTGCAAGGCACAGG - Intergenic
1176412659 21:6457428-6457450 TGCCCCTGTGTCCCAGGCAGGGG - Intergenic
1178442472 21:32610154-32610176 TGCCCCCGTGTCAAAGGCCCAGG - Intronic
1179688153 21:43065750-43065772 TGCCCCTGTGTCCCAGGCAGGGG - Intronic
1180468028 22:15634650-15634672 AGCCTCTGAGTCCAGGGCACAGG - Intergenic
1180552011 22:16548274-16548296 TCTCCCCCAATCCAAGGCACTGG - Intergenic
1183346089 22:37309151-37309173 TCCACCCGAGTCCAAGGCCTAGG - Intronic
1183986795 22:41574654-41574676 TGCCCCCAAGGCCAGGCCACAGG + Intronic
1184144650 22:42602379-42602401 TGGCCCCTAGTCCAAGGCCCTGG - Intronic
949648225 3:6123595-6123617 AGCCCCCAAGGACAAGGCACCGG - Intergenic
953916516 3:46924093-46924115 TGCTCCCAAGACCAGGGCACAGG + Intronic
964032901 3:152159563-152159585 TGCTTCAGAGTCCAAGCCACTGG + Intergenic
968972364 4:3802684-3802706 TGCCCCAGAGTCCAGGACAAAGG - Intergenic
969841898 4:9888949-9888971 TGCCCCTGGGTGCCAGGCACTGG + Intronic
978293541 4:107175589-107175611 TGGCCCTGAGGCCAAGGCTCTGG + Intronic
983269999 4:165550341-165550363 TGGCCATGAGTCCAAGGCCCAGG - Intergenic
985620505 5:952451-952473 TGCCCCTGAGTCCGGAGCACAGG + Intergenic
987064162 5:14271483-14271505 TGCCCCCAAGCCCAAGGGACTGG - Intronic
988851799 5:35187866-35187888 TACCTCCAAGTCCAAGGCAATGG - Intronic
988852066 5:35190040-35190062 TACCTCCAAGTCCAAGGCAATGG - Intronic
990545467 5:56816436-56816458 TGTCCCCGGGGCAAAGGCACTGG + Intronic
992391265 5:76332881-76332903 TGCCCCTAAGTCCAAGGAAGGGG + Intronic
995561516 5:113386944-113386966 TGGCCCTGAGACCAAGGCAAGGG - Intronic
995960155 5:117829710-117829732 TCCCCCAGAGTCCAAAACACTGG - Intergenic
997689918 5:135821451-135821473 TTCCCCCAAGTCCAGGGAACTGG - Intergenic
1002322196 5:178382723-178382745 TGCCCCCGAGTCCTGGGCCTGGG - Intronic
1003489676 6:6610436-6610458 TGCCCCAGAGGCCAGGGCAGTGG - Intronic
1006406984 6:33851204-33851226 TGGTCCCGAGTCCAAGGTATGGG + Intergenic
1007506748 6:42341482-42341504 TGCCCCGGAGTCTAAGGCCCCGG + Intronic
1010926765 6:81753496-81753518 TGCCCCGGAGTCCAGGGAAAGGG + Intergenic
1013179784 6:107708113-107708135 TGCCCATGAGTCCAAGGACCTGG + Intronic
1017821298 6:158050759-158050781 TGCCCTTGAGTCCAGGGAACAGG - Intronic
1017846096 6:158259911-158259933 TGCCCCTGACTCCATGGCATGGG - Intronic
1020762289 7:12283455-12283477 TGAGACTGAGTCCAAGGCACGGG - Intergenic
1027217241 7:76191900-76191922 TGCCCAGGATTCCAAGGCCCTGG - Intergenic
1028124231 7:87093589-87093611 GGTCCCTGAGTACAAGGCACAGG - Intergenic
1033443204 7:141398397-141398419 TTCCCCAGACTCCAAGGCATAGG - Intronic
1034272735 7:149811242-149811264 TGCCACCGAGTGCCATGCACTGG + Intergenic
1036702503 8:11022427-11022449 TCCCCCTGGGTCCAAGGCAGAGG + Intronic
1036774404 8:11600181-11600203 AGCCCACGAGTCCAAGGCTGTGG - Intergenic
1038013798 8:23496446-23496468 TGCCCCTGAGAGCAAGGTACTGG + Intergenic
1038493656 8:27987049-27987071 TGCCCCTGGGTGCAAGGCCCTGG - Intronic
1041538478 8:58955665-58955687 AGTCCCTGAGTCCAGGGCACTGG + Intronic
1049020386 8:139953052-139953074 TGCCTCTGAATCCAGGGCACTGG - Intronic
1051346115 9:16152636-16152658 TGCCCTCGAGTCTAAGGCCATGG - Intergenic
1057186377 9:93059476-93059498 TGCTCCCGTGCCCAAGGCTCCGG + Intronic
1057294841 9:93828780-93828802 AGCCCCCCAGTCCACGGCGCAGG - Intergenic
1059397771 9:114049212-114049234 CACCACCGAGTTCAAGGCACAGG - Exonic
1062294374 9:135816290-135816312 TGCCCCCGTGAGCAGGGCACAGG + Intronic
1062619031 9:137411313-137411335 TGCCCCCGAGCCCTGGGCATGGG + Intronic
1203775679 EBV:71893-71915 TGCCCCCGGCTCCACGGCCCCGG + Intergenic
1185504307 X:620085-620107 TCCCCCCAACTCCAAGGAACGGG - Intergenic
1193028915 X:76876885-76876907 TGCCCCCAAGTAAAAGGCACAGG + Intergenic