ID: 1097162717

View in Genome Browser
Species Human (GRCh38)
Location 12:57060179-57060201
Sequence CAGAGTAAGGACAAGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097162717_1097162722 9 Left 1097162717 12:57060179-57060201 CCAACATCCTTGTCCTTACTCTG 0: 1
1: 0
2: 1
3: 15
4: 277
Right 1097162722 12:57060211-57060233 TAGACTAAAGCATGAAGTTAAGG 0: 1
1: 0
2: 1
3: 14
4: 168
1097162717_1097162724 25 Left 1097162717 12:57060179-57060201 CCAACATCCTTGTCCTTACTCTG 0: 1
1: 0
2: 1
3: 15
4: 277
Right 1097162724 12:57060227-57060249 GTTAAGGAGAAAAGGAAAGCTGG 0: 1
1: 1
2: 9
3: 81
4: 903
1097162717_1097162725 26 Left 1097162717 12:57060179-57060201 CCAACATCCTTGTCCTTACTCTG 0: 1
1: 0
2: 1
3: 15
4: 277
Right 1097162725 12:57060228-57060250 TTAAGGAGAAAAGGAAAGCTGGG 0: 1
1: 0
2: 7
3: 77
4: 765
1097162717_1097162723 17 Left 1097162717 12:57060179-57060201 CCAACATCCTTGTCCTTACTCTG 0: 1
1: 0
2: 1
3: 15
4: 277
Right 1097162723 12:57060219-57060241 AGCATGAAGTTAAGGAGAAAAGG 0: 1
1: 0
2: 3
3: 52
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097162717 Original CRISPR CAGAGTAAGGACAAGGATGT TGG (reversed) Intronic
901507605 1:9695314-9695336 CGGAGGAAGGAAAAGTATGTAGG + Intronic
903002987 1:20279604-20279626 CAGGTTAAGGACAGGGAAGTAGG + Intergenic
903786399 1:25863959-25863981 GAGTGTAAGGATAAGGCTGTCGG - Intronic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
905679423 1:39857084-39857106 CAGTCTAAGGACAAGAATTTGGG + Intronic
906493775 1:46288520-46288542 CAGACTAAAGCCAAGGCTGTGGG + Intronic
907293362 1:53433033-53433055 CCGAGTGAGGGCAAGGATGGGGG - Intergenic
909977095 1:82058063-82058085 AAGAGTTAGGAGAATGATGTTGG + Intergenic
910080207 1:83332872-83332894 CTGAGTGAGGAAAAGGTTGTTGG - Intergenic
912623293 1:111187491-111187513 CAGAGTGAGGATATGGATTTTGG + Exonic
913073115 1:115318726-115318748 GAGAGTAGGGACAAGCAGGTGGG - Intronic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
913650145 1:120905861-120905883 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
913707957 1:121446939-121446961 CAGAGTAAGTATAAGTATATTGG + Intergenic
914076528 1:144357644-144357666 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914102650 1:144608853-144608875 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
914170975 1:145223224-145223246 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914526089 1:148467192-148467214 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914640314 1:149599931-149599953 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
919399609 1:197095714-197095736 TAGAGTAAGGACAGAGACGTAGG - Intronic
919676385 1:200387718-200387740 CAGAGTAAGAAAAAGGAGATGGG + Intergenic
920507343 1:206525899-206525921 GAGAGTAAAGACCAGGATCTTGG + Intronic
920928472 1:210365072-210365094 CAGAGGAAGGACATTGATATGGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
923121561 1:230997204-230997226 CAGAGTATGGAATGGGATGTTGG + Exonic
1064565555 10:16635622-16635644 CAGAGTGGGGACAATGAGGTAGG - Intronic
1064646494 10:17465032-17465054 CAGAGCAATGCTAAGGATGTAGG - Intergenic
1065256369 10:23873135-23873157 CAGTGTAAGGACAATAATCTGGG + Intronic
1066124421 10:32326141-32326163 AAGAGGAAGGATAAGGAAGTAGG - Intronic
1067148198 10:43709025-43709047 CCTGGTAAGTACAAGGATGTGGG + Intergenic
1067148203 10:43709053-43709075 CCTGGTAAGTACAAGGATGTGGG + Intergenic
1067148211 10:43709109-43709131 CCCAGTAAGTACACGGATGTGGG + Intergenic
1067148358 10:43709893-43709915 CCCAGTAAGTACAAGGATATGGG + Intergenic
1067148363 10:43709921-43709943 CCTAGTAAGTACTAGGATGTGGG + Intergenic
1067148402 10:43710145-43710167 CCCAGTAAGTACAAGGATATGGG + Intergenic
1067148407 10:43710173-43710195 CCTAGTAAGTACTAGGATGTGGG + Intergenic
1067187894 10:44045508-44045530 CAGTGTGAGGACCAGGATGCTGG + Intergenic
1067451445 10:46384458-46384480 CTGAGTAAGGACAAGTGTGGGGG - Intronic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1068075957 10:52254199-52254221 CAGAGTTAGGAGTAAGATGTAGG + Intronic
1069718398 10:70535008-70535030 CACAGGAAGGACAAGGAAGAGGG + Intronic
1070155814 10:73834556-73834578 CAGAGGAAGGACAGAGAGGTAGG - Intronic
1070595657 10:77831009-77831031 CAGAGTCAGGTCAAGGCTGCTGG + Intronic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1073786690 10:106897748-106897770 TAGTGGAAGGACAAGGATTTTGG - Intronic
1075518275 10:123127061-123127083 CAGAGTCAGGAGGAAGATGTGGG + Intergenic
1076026437 10:127118620-127118642 CAGAGCAAGTAAAAGGGTGTTGG - Intronic
1077023202 11:428728-428750 CAGGGTCAGGACGAGGATGACGG + Exonic
1077485910 11:2838366-2838388 CAGAGTGAGGCCAGGGATGGGGG + Intronic
1081151805 11:39641861-39641883 AAGGTTAAGGACAAGGATTTGGG + Intergenic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1083492801 11:63025493-63025515 CAGAGCAAGTGCAAGGATGGAGG - Intergenic
1083775379 11:64892018-64892040 AAGAGTAAGGCCGAGGATGGCGG + Intergenic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1088814209 11:113410403-113410425 CAGAGGAAGGTCAAGGAAGGCGG + Exonic
1089098935 11:115944198-115944220 CTGAGTTTGGAAAAGGATGTTGG + Intergenic
1090416631 11:126544817-126544839 CAGATTAAGGCCAGGAATGTCGG - Intronic
1091383241 12:76535-76557 CAGAGAAAGGAAAAGGAACTGGG - Intronic
1093647349 12:21602297-21602319 CAGAGTTAGGACCAGGATTTAGG - Intronic
1094023179 12:25935762-25935784 CAGAGGAAGGACAACGTTGAGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1098243404 12:68490795-68490817 CAGAGAAAGGGCATGGATCTGGG + Intergenic
1098595535 12:72270799-72270821 CAGAGTATGTATAAGTATGTGGG - Intronic
1101908310 12:108844356-108844378 CAGAGCATGAACAAGCATGTGGG + Intronic
1101927142 12:108981529-108981551 CAGAGTCAGAACAAGGTCGTGGG + Intronic
1103290265 12:119839865-119839887 AAGAGCAAGGACAGGGATTTCGG + Intronic
1103397939 12:120622318-120622340 GGGAGTAAGGAGCAGGATGTCGG + Intergenic
1104234289 12:126918009-126918031 CTTAGCAAAGACAAGGATGTAGG - Intergenic
1104400646 12:128473219-128473241 TGGAGTAAGGACAAAGATGGAGG - Intronic
1104419946 12:128627035-128627057 CACAGTGAGGACAAAGATGCCGG - Intronic
1105039386 12:132949788-132949810 CAGAGCAAGGACACTGAGGTAGG + Intronic
1110840143 13:80132850-80132872 CAAAGAGAGGACAAGTATGTGGG - Intergenic
1112976701 13:105328790-105328812 CAAAGTAAGTACCAGGATGGGGG - Intergenic
1113322193 13:109244895-109244917 GTGAGTAAGGAGAAGAATGTTGG + Intergenic
1113705778 13:112432186-112432208 CAGAGAAAGCACAAAGATGTAGG + Intronic
1114152573 14:20060769-20060791 CAGAGTGACCACAATGATGTGGG - Exonic
1114774493 14:25465879-25465901 AAGAGTAAATACAAGGATTTGGG - Intergenic
1115465369 14:33708963-33708985 CAAAGTAAGGACAAGAAAATTGG + Intronic
1116505119 14:45668310-45668332 CAGATTAAAGACAAGGTTCTAGG + Intergenic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1120248540 14:82033910-82033932 GACAGTAAGGACAAGGAGATTGG + Intergenic
1120268834 14:82284634-82284656 CCAAGTAAGGACAAGGAACTTGG + Intergenic
1122188063 14:100017062-100017084 CAGAGTAATGACATGGATTCCGG - Intronic
1122630636 14:103106250-103106272 CAGATTAAGGACGAGAGTGTTGG - Intronic
1123929043 15:25149389-25149411 CAGACTCAGAACAAAGATGTTGG + Intergenic
1124641228 15:31397817-31397839 CAGAGTTAGGAGCTGGATGTGGG + Intronic
1125134018 15:36320073-36320095 AAGAGTAAGTACAAGGAAGCTGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126902290 15:53326854-53326876 GACAGTAAGGAAAAGGATCTTGG + Intergenic
1127704849 15:61536509-61536531 CAGAGTAAGGACATGCAAGGTGG - Intergenic
1127799834 15:62468299-62468321 CAGAATGATGACAAGGGTGTTGG + Intronic
1128326403 15:66726672-66726694 CAGAGTCAGGACTAGGAGCTGGG - Intronic
1130092027 15:80829199-80829221 CTGAGGAAGGCCAGGGATGTGGG - Intronic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130789830 15:87142247-87142269 CAGACTCAGCACAAGAATGTAGG - Intergenic
1130940102 15:88500659-88500681 CCTAGTATTGACAAGGATGTAGG - Intergenic
1131347680 15:91665916-91665938 CAGAGCCAGGACAAGGGTGAGGG - Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132752432 16:1464972-1464994 CAGGGCAAGGACAGGGATCTTGG - Intronic
1133759279 16:8785475-8785497 CAGTGTAAGGAGCAGGACGTGGG + Intronic
1135267248 16:21038045-21038067 CGGGGCAAGGACAAGGATATTGG - Intronic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136053037 16:27666737-27666759 CAGAGTTAGGACAGGCATGGTGG + Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1140519346 16:75567937-75567959 CAGAGTGTGGGCAAGGAGGTGGG - Intronic
1140820176 16:78656294-78656316 CAGAGAAAGGACATGCATGTTGG - Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143712284 17:8743226-8743248 CAGTGCAAGGACAAGGATGGAGG + Intronic
1143818535 17:9540530-9540552 GAGAGGAAGGAGAATGATGTCGG - Intronic
1144431209 17:15193455-15193477 CAGAGTTCGGAGAAGGTTGTGGG + Intergenic
1147547331 17:41412161-41412183 CAGAGGTAGGAAAAGAATGTGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149523497 17:57336258-57336280 AAGAGTAAGGCCAAGGCTTTTGG + Intronic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1153983395 18:10331907-10331929 CAGAGTAAGGACCAGTGTGATGG + Intergenic
1155698264 18:28710698-28710720 CAGAAGAAGTACAAGGATTTAGG + Intergenic
1155825601 18:30438874-30438896 CAGTGTATGGGCAAGGCTGTGGG - Intergenic
1156056689 18:33014003-33014025 CAGACTGTGGGCAAGGATGTTGG - Intronic
1159834405 18:73319897-73319919 TGGAGTAAGGACTAGGATGATGG + Intergenic
1161128088 19:2571386-2571408 CAGAACAAGGATAAGGATATAGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1162449963 19:10748665-10748687 CAGAGCCAGGACACGAATGTGGG - Intronic
1162640357 19:12003673-12003695 AAGAGTAAAGACAAGAGTGTTGG + Intergenic
1163606556 19:18279084-18279106 CAAAGTAGGGAGTAGGATGTTGG + Intergenic
1165334092 19:35156923-35156945 CAGAGGCAGGACCAGGATGGGGG + Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166148750 19:40855433-40855455 CAGATTGATGACAAGGATTTGGG + Intronic
1166152890 19:40887218-40887240 CAGATTGATGACAAGGATTTGGG + Intronic
1166171689 19:41032158-41032180 CAGAGTGATGACAAGGATAAAGG + Intergenic
1166177330 19:41083683-41083705 CAGAGTGATGACAAGGATTAGGG - Intergenic
1166882073 19:45935758-45935780 CAAAGTAAGAAGGAGGATGTGGG + Exonic
925591163 2:5511421-5511443 CACAGTAAGGACATGGGTGAAGG - Intergenic
925950723 2:8907916-8907938 CAGTGTAAGGATAAGTGTGTTGG - Intronic
926024236 2:9526506-9526528 CAGAGTAAGGCCGGGCATGTTGG + Intronic
928044245 2:27911462-27911484 CAGAGAAAGGACAATAAGGTAGG + Intronic
928069872 2:28203943-28203965 CAAAGTATTGGCAAGGATGTAGG - Intronic
928720448 2:34114784-34114806 AAGAGAAATGCCAAGGATGTGGG - Intergenic
929307121 2:40376127-40376149 AAGAGGAATGACAAAGATGTTGG - Intronic
933314243 2:80697061-80697083 CAGATGAAGGACATGGATGTTGG + Intergenic
935129028 2:100247595-100247617 CAGAGGCAGGACGAGGATGCAGG + Intergenic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
936606255 2:113958117-113958139 AAGAGTAAAGACAAGAGTGTTGG + Exonic
937159792 2:119749404-119749426 CAGAGCCAGGTTAAGGATGTTGG - Intergenic
937713884 2:125010103-125010125 CAGACTAAAGACAATGATGAAGG - Intergenic
938248474 2:129796530-129796552 CAGCGTAGGGGCAAGGTTGTGGG - Intergenic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
939875357 2:147571448-147571470 GACAGTGAGGACAAGGAGGTTGG + Intergenic
941994789 2:171592121-171592143 CAGAGTAAAGTCAAGGCAGTGGG - Intergenic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942666881 2:178329263-178329285 TAGAGATAGGACAAGGATGTTGG - Intronic
945857896 2:215090354-215090376 CAGAGTGAGGACAAGGACAGGGG - Intronic
946799727 2:223400826-223400848 CAGAGTAAGTACAAGGTAGTGGG + Intergenic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
947393242 2:229661514-229661536 CTGACTAAGGACAATGATCTAGG - Intronic
947768218 2:232651069-232651091 CAGGGTTAGGCCAAGCATGTGGG + Intronic
947919970 2:233861726-233861748 TAGAGAAAGGACAAGGAACTTGG - Intergenic
948121068 2:235530860-235530882 CAGAGGAAGGACACTGAGGTGGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1169501599 20:6165986-6166008 CAGACTAAGAACAAAGTTGTGGG + Intergenic
1169868923 20:10230884-10230906 CAGAGTGAGGACAAGTGTGTGGG + Intronic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1173173902 20:40749783-40749805 CACAGTGAGGGCAAGGCTGTGGG + Intergenic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175238317 20:57527398-57527420 CAGAGAAAGGGCAGGAATGTGGG + Intergenic
1175986544 20:62766730-62766752 CAGAGAAAGGAAAGGGCTGTGGG - Intergenic
1179900316 21:44389532-44389554 CCAAGTGTGGACAAGGATGTAGG - Intronic
1182731601 22:32500301-32500323 CAGTTTAATGACAAGAATGTAGG - Intergenic
1184487440 22:44789004-44789026 CAGAATATGCATAAGGATGTAGG - Intronic
1184553480 22:45218691-45218713 CAGGCTAAGGATAAGGATGTGGG - Intronic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
949573194 3:5313071-5313093 CATACTAAGTACAAGGATCTGGG + Intergenic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
950486437 3:13276659-13276681 CAGAGCAAGGCCAAGGCTGATGG + Intergenic
951578040 3:24133724-24133746 CAGAGAAAGGACAGGAATTTGGG + Intronic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
955117197 3:56017539-56017561 GAGAGCAAGTACAAGGGTGTGGG - Intronic
955349821 3:58185121-58185143 CTGAGGAAGGCCAAGGATGCTGG - Intergenic
955370835 3:58350402-58350424 CAGAGTAAGGACAAGAACCCGGG - Intronic
955584460 3:60461772-60461794 CAGAGGCAGGATAAGGATGGGGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955918695 3:63931884-63931906 CACAGGAAGGACGAGGGTGTGGG + Intronic
956050710 3:65245285-65245307 CAAAGCAAAGACAAGGAAGTTGG + Intergenic
957140181 3:76344784-76344806 CAGAGTAAAGTCAAGAATTTGGG + Intronic
961746841 3:129069226-129069248 CAGAGCAAGGACACGAATTTGGG - Intergenic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
963836569 3:150063521-150063543 CAGAGTTGGGACAAGCCTGTAGG + Intergenic
964200784 3:154116601-154116623 CAGAGTAAGAATAAGCATTTTGG - Intergenic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
970166573 4:13244172-13244194 CAGAGTGAGGAAAACCATGTGGG - Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
972179229 4:36443440-36443462 CTGAGTAAGGAAATTGATGTAGG - Intergenic
972407248 4:38758522-38758544 CAGAGTAACAACAAGCAGGTTGG + Intergenic
973963663 4:56137923-56137945 AAGGGTAAGGATAAGGAAGTGGG + Intergenic
976673936 4:87683895-87683917 CACAGTAAGGATAAAGATGGAGG - Intergenic
977318240 4:95478308-95478330 AAGAATAAGGACAAGGATTGGGG + Intronic
978303461 4:107295404-107295426 CAGAGTGAGGACAAGGACAGAGG + Intergenic
978985453 4:115006599-115006621 CAGAGGAAGAACAAGTTTGTGGG + Intronic
979712972 4:123802653-123802675 GAGAGCAAGGAGAAGTATGTAGG - Intergenic
979792594 4:124804416-124804438 CAGAGTAAGGCAAAGAAGGTGGG - Intergenic
981988934 4:150892475-150892497 CACAGCAAGGAAGAGGATGTAGG + Intronic
982220165 4:153117766-153117788 CACAGTATTGGCAAGGATGTGGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983307950 4:166017865-166017887 CAGGATAAGGACAATGATATTGG + Intronic
983457847 4:167986448-167986470 CATAGCATGGACTAGGATGTTGG + Intergenic
985347503 4:189022056-189022078 CAAAGGAATGACAGGGATGTGGG + Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
987473219 5:18357821-18357843 CAGAGTTAGGAGAATGCTGTTGG - Intergenic
989103717 5:37841803-37841825 CAGAGTAAGAACATTGATGAGGG - Intergenic
989981251 5:50648392-50648414 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
990476116 5:56163158-56163180 CAGAGTGAGGGCAAGAATGCAGG - Intronic
992738389 5:79746835-79746857 CAGTGTCAGGACAGGGATGGAGG - Intronic
993989942 5:94643793-94643815 CCAAGTAAGGAGGAGGATGTAGG - Intronic
994277989 5:97862834-97862856 CAGAGCCAGGACAAAGATGGAGG - Intergenic
994723732 5:103410202-103410224 CAGTGGTAGGACAAGGATGAGGG + Intergenic
998617925 5:143761317-143761339 TAGATTAAGGACATGGAGGTGGG + Intergenic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
999826463 5:155278121-155278143 CAGAGTAGGGCCAAGCATGGTGG - Intergenic
1000294086 5:159897886-159897908 CAGAGTAAGGACAAGGGCACTGG + Intergenic
1000700190 5:164439915-164439937 CAGAGGAAGGTAAAGGATTTAGG + Intergenic
1000749459 5:165075367-165075389 GAGAGTAAGGAAAAGCATGGTGG - Intergenic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1001945649 5:175775369-175775391 CAGAGTTTGGAAAAGGATGGGGG - Intergenic
1002083165 5:176749373-176749395 CAGAGTCAGGAAATGGATGTTGG - Intergenic
1002493267 5:179594807-179594829 CAGAGCAGGTGCAAGGATGTGGG + Intronic
1006741352 6:36311300-36311322 CAGACTGAGGATAAGGGTGTGGG + Intergenic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011975743 6:93295693-93295715 TAGAGTAAAGACAATTATGTAGG - Intronic
1012413469 6:98987042-98987064 CAGAAGAAGGACAAGAATCTGGG + Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1015203779 6:130612427-130612449 CTGAATAGGGACAAGGAAGTTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1020677308 7:11197456-11197478 TAGATTAAGGATAAGGATGAAGG - Intergenic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1028884175 7:95912773-95912795 CAGAGGAAGGACAAAAGTGTGGG - Intronic
1030184996 7:106752805-106752827 TAGAGTTAGGACAAGGAAATGGG + Intergenic
1032466447 7:132148627-132148649 CAGAGTGGCGACAAGGAAGTGGG - Exonic
1032689959 7:134275873-134275895 CACAAAAAGGACAAGGATATTGG + Intergenic
1034886321 7:154801724-154801746 CAGTGTAAGGCCAAGGATGTTGG + Intronic
1036360634 8:8074422-8074444 CAGAGTTAGGACAAGAGGGTCGG + Intergenic
1036890336 8:12592544-12592566 CAGAGTTAGGACAAGAGGGTTGG - Intergenic
1040786494 8:51170772-51170794 GAGAGTAAGGATAAAGATCTGGG + Intergenic
1044161923 8:88929621-88929643 TATAATAACGACAAGGATGTTGG + Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1045512447 8:102822802-102822824 CAGTGTAGGGAAAAGGATCTGGG - Intergenic
1048727177 8:137400130-137400152 CAGAGGGAGGACAAAGATGCTGG + Intergenic
1050644604 9:7705512-7705534 ATGAATAAGGACAAAGATGTTGG + Intergenic
1051327290 9:15986604-15986626 AAGTGAAAGGACAAGGATCTAGG - Intronic
1051527603 9:18064204-18064226 AAGAGCAAGGAGAAGGGTGTGGG + Intergenic
1051990151 9:23143200-23143222 CAGAGGCAGGGCAAGGCTGTTGG + Intergenic
1055448759 9:76410952-76410974 CAGAGTAAGGAAAATGATCAGGG - Intergenic
1056788379 9:89609356-89609378 CAGAGGAAAAGCAAGGATGTTGG + Intergenic
1060010015 9:120035627-120035649 CAGGGAAAGGAAAAGAATGTAGG + Intergenic
1060860023 9:126946571-126946593 CAGAGTTAGGAAAAGGAAATGGG + Intronic
1061297760 9:129686237-129686259 CAGAGTCAAGACAAGGGTGAGGG + Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1062089161 9:134665678-134665700 CAGAGCAGGGACAGGGACGTGGG + Intronic
1062369011 9:136227127-136227149 CGGAGCAGGGACAAGGCTGTGGG + Intronic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1203652182 Un_KI270751v1:136195-136217 CAGAATAAGGCCAAGCATGGTGG + Intergenic
1186277545 X:7956442-7956464 CAGAGTCAGAACAGGGCTGTAGG - Intergenic
1186820356 X:13281821-13281843 CAGTCTAGGGACATGGATGTGGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1190056663 X:47185235-47185257 CAAAGGAAGGACAAGATTGTGGG - Intronic
1190570745 X:51779076-51779098 CAGAGCATGGACAGGGATGATGG - Intergenic
1192180141 X:68911125-68911147 CAGAGTAAGGACAGGGCTACTGG + Intergenic
1192593333 X:72380424-72380446 CAGAATATGGACTAGAATGTTGG - Intronic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195425394 X:104723644-104723666 CAGAGAAATGACAAGGAATTTGG + Intronic
1196184315 X:112729427-112729449 CAAAGTAAGGACTAGTATCTAGG + Intergenic
1197715007 X:129700301-129700323 CACAGTAAGGACACTGATGCAGG - Intergenic
1198087388 X:133293932-133293954 AAGAGTAAGGGCAGGGAGGTGGG - Intergenic
1199606347 X:149582637-149582659 AAGAGCAGTGACAAGGATGTAGG + Exonic
1199615067 X:149649579-149649601 CAGGGAAGTGACAAGGATGTAGG + Intergenic
1199632775 X:149786731-149786753 AAGAGCAGTGACAAGGATGTAGG - Exonic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1201601657 Y:15736143-15736165 TAGAGTAAGGATTAGGAAGTTGG + Intergenic