ID: 1097164782

View in Genome Browser
Species Human (GRCh38)
Location 12:57078248-57078270
Sequence TGGGCAGGCAGAGCAGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 404}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097164782_1097164785 -9 Left 1097164782 12:57078248-57078270 CCCGCGGCTGCTCTGCCTGCCCA 0: 1
1: 0
2: 2
3: 47
4: 404
Right 1097164785 12:57078262-57078284 GCCTGCCCAGAATGGTCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 168
1097164782_1097164792 21 Left 1097164782 12:57078248-57078270 CCCGCGGCTGCTCTGCCTGCCCA 0: 1
1: 0
2: 2
3: 47
4: 404
Right 1097164792 12:57078292-57078314 GCTTTTAACCAAGAAACTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097164782 Original CRISPR TGGGCAGGCAGAGCAGCCGC GGG (reversed) Intronic
900401404 1:2474354-2474376 AGGGCAGGCAGGGCAGCCCCCGG + Intronic
900403059 1:2480540-2480562 AGAGCTGGCAGAGCAGCCCCCGG - Intronic
900408685 1:2503370-2503392 TGGGCAGGTAGTGCAGCTGCTGG + Intronic
900473731 1:2866664-2866686 TGGGCAGGGGGAGGAGCTGCTGG + Intergenic
900501282 1:3005929-3005951 TGGGCAGGCAGGGCAGGGGAGGG + Intergenic
900549389 1:3246538-3246560 TGGGCCTGCAGGGCAGCGGCAGG - Intronic
900851062 1:5143421-5143443 AGGGAAGGCACAGCAGCCCCTGG + Intergenic
901035626 1:6334424-6334446 TGCCCAGGCAGAGCAGCCCAGGG + Intronic
901089013 1:6629265-6629287 TGGGCAGGCAGGGCAGTGGCGGG + Intronic
902232419 1:15036363-15036385 TGGGCAGGCAGGGCAGGGGAGGG - Intronic
902651621 1:17841240-17841262 TGGCCAGCCAGAGGAGCTGCAGG - Intergenic
903283582 1:22263781-22263803 TGGGCAGCCAGAACAGGGGCAGG + Intergenic
904006589 1:27366312-27366334 AGGGCAGGCTGCGCAGCTGCGGG + Exonic
904830982 1:33306723-33306745 TGGGCCGGCGGAGAAGCCGGAGG + Intergenic
906194432 1:43921005-43921027 TGGGCAGCCAGACCAGCCACTGG - Intronic
906462223 1:46043524-46043546 TGGAGAGGCCGAGCAGCAGCCGG - Exonic
907384978 1:54120503-54120525 GGTGCAGGCAGAGCAGTGGCTGG + Intergenic
908001980 1:59689262-59689284 AGGACAGGCAGAGAAGCAGCAGG + Intronic
909691902 1:78418270-78418292 TTGGTAGGCAGAGCACCTGCAGG + Intronic
912805930 1:112757100-112757122 TGGGCAGTCAGAGCGGCCCAGGG + Intergenic
913117926 1:115713714-115713736 CGAGCAGGCAGAGCAGGCGGAGG - Intronic
913217733 1:116634663-116634685 TGGGTAAGCAGAGCAGGCACGGG - Intronic
915279657 1:154813844-154813866 GGGCCAGGGAGAGCAGCCGGGGG + Intronic
915490441 1:156247435-156247457 TGGGCAGGCGGAGCCGCCCCAGG + Intronic
915518487 1:156427951-156427973 TGGGCTGGCAGAGCTGAGGCTGG - Intronic
915736644 1:158089478-158089500 TGGGCAGAGAGAGCAGCCTCGGG - Intronic
916524311 1:165595064-165595086 TGGGCAGGCAGAGCACATTCTGG + Intergenic
916602603 1:166307647-166307669 TAGGCAGGCAGAGGAGGGGCAGG - Intergenic
917920033 1:179743480-179743502 CGGGCGGGCTGAGGAGCCGCCGG + Intronic
917969383 1:180197252-180197274 TGTGCAGGGAGGGCAGCCCCGGG + Exonic
918239891 1:182611868-182611890 TGGGCCGGCAGAGTGGCGGCGGG + Intergenic
921029945 1:211327766-211327788 GTGGCAGGCAGAGCTGCCTCAGG + Intronic
922235281 1:223717903-223717925 TGGGAAGGGAGAGAAGCCACAGG - Intronic
924257522 1:242197149-242197171 TGGGCTGGCTGAGCTGCCCCAGG - Intronic
924386260 1:243500656-243500678 TGGCCAGGCAGGGCAGCCGAAGG - Exonic
924428399 1:243974754-243974776 TGGGCAGGGATGGGAGCCGCAGG - Intergenic
924631272 1:245743074-245743096 TGGGCAGGCAGGGGGGCAGCCGG - Intergenic
924741291 1:246795489-246795511 TCTCCAGGCAGAGCAGCAGCTGG - Intergenic
1063602926 10:7498306-7498328 TGGGCTGACAGAGCAGCAGATGG + Intergenic
1064428201 10:15248682-15248704 TGGCCACGCAGAGCAGCCTGAGG - Exonic
1065528543 10:26646224-26646246 TGTGCAGACAGAGAAGGCGCAGG + Intergenic
1067030294 10:42875198-42875220 CAGGCAGGCAGAGCAGGCGGCGG + Intergenic
1067343576 10:45422452-45422474 TGGGCAGGAAGGGGAGCCACTGG + Intronic
1067546893 10:47198357-47198379 AGGGTAAGCAGAGCAGCCTCTGG - Intergenic
1067746208 10:48938462-48938484 GGGGCTGGCAGAGCAGCCTGTGG - Intronic
1067806657 10:49397562-49397584 GGGGCCGGCAGGGCAGCCGAGGG + Intergenic
1069719134 10:70538957-70538979 TGGGCATGCGGGGCACCCGCCGG - Exonic
1070161252 10:73867967-73867989 TGGCCAGACAGATCTGCCGCAGG - Intronic
1070743782 10:78920215-78920237 TGGGCAGGCACAGCAGGTGTAGG + Intergenic
1070924263 10:80207683-80207705 TGGGGCGGCAGAGCAGGCGCAGG - Intergenic
1071497461 10:86178911-86178933 TGGGCAGGCATTGCAGAGGCTGG + Intronic
1072634568 10:97169591-97169613 AGGGCAGCCAGGGCAGCCGGTGG + Intronic
1072685142 10:97532136-97532158 TGGGCCGGGAGAGCAGCCAGTGG + Intronic
1072758232 10:98035319-98035341 TCTGCAGGCAGAGCAGCCCCAGG + Intergenic
1073283860 10:102375355-102375377 TGCGCAGGGAGAGCAGCACCTGG - Exonic
1074203294 10:111258638-111258660 TGAGCAGGCAGACCAGCCTGAGG - Intergenic
1075686891 10:124370649-124370671 TGGCCAGGCAGGGCAGCCAAGGG + Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1076326390 10:129626610-129626632 TGGGCATGCAGAACAGCCAAGGG - Intronic
1076437166 10:130454265-130454287 CAGGCAGACAGAGCAGCCCCAGG - Intergenic
1076564937 10:131392209-131392231 TGGGCAGGCAGTGAGGCAGCAGG - Intergenic
1076980706 11:203176-203198 TGGTCTGGCACAGCAGCAGCAGG + Exonic
1077180103 11:1208476-1208498 GGGGCAGGCCGAGCAGCAGAGGG - Intergenic
1077216998 11:1399095-1399117 TGGGCAGGCAGCCCCGCCCCAGG + Intronic
1077344281 11:2039209-2039231 TGGGCAGGCAGGGGAGCCCAGGG + Intergenic
1077442313 11:2574471-2574493 GGGGCGGGCAGGGCAGCCGTGGG + Intronic
1077614869 11:3667379-3667401 TGAGCACGCAGGGCAGCAGCAGG + Exonic
1078659934 11:13278187-13278209 AGGGCAGGCAGAGGTGCTGCAGG + Intronic
1079237133 11:18698974-18698996 TCGGCAGGCCGAGCTGCCGAAGG + Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1081100075 11:38990293-38990315 TGGGCAGGCAAAGGAGTGGCAGG - Intergenic
1081989432 11:47329820-47329842 TGCTCAGGCAGAGCAGCCAGCGG - Exonic
1083272118 11:61577887-61577909 TGGGCAGGCAGGACAGCGGCAGG - Intronic
1083326080 11:61873698-61873720 AGGGCAGGCAGGGCACCCCCAGG + Exonic
1083680446 11:64349305-64349327 AGGGCAAGCAGAGCAGGCTCAGG - Intronic
1083775146 11:64890980-64891002 AGGGCAGGCAGGGCAGGGGCAGG + Intergenic
1083783422 11:64930183-64930205 TGGGAAGGGAGCGCAGCCTCTGG + Intronic
1083953121 11:65967612-65967634 GGGGCAGGGACAGGAGCCGCGGG + Intronic
1084013625 11:66366254-66366276 TGAGCAGGCAGGGCAGTCCCAGG + Intronic
1084385565 11:68841261-68841283 TGGGCAGGGACAGGAGCCGGAGG + Intronic
1084407048 11:68980129-68980151 TGGGCAGCCGGAGGAGCCACAGG - Exonic
1085280236 11:75325267-75325289 TGGGCAGCCAGAGTAGGGGCTGG - Intronic
1085353457 11:75815459-75815481 CCGGGAGGCAGAGCAGCGGCCGG - Exonic
1085784692 11:79439530-79439552 GGGGCAGGCAGAGAAGGGGCGGG + Intronic
1087006724 11:93478962-93478984 TCGGCAGGGAGAGGAGGCGCGGG - Exonic
1087868846 11:103266515-103266537 TTGGCAGGCAGAGAACCAGCTGG - Intronic
1088001343 11:104885370-104885392 TGGACAGACAGAGCAGCAGGTGG + Intergenic
1089200810 11:116723793-116723815 TGGGCAGGCAGGGCTGTGGCTGG - Intergenic
1089273371 11:117316170-117316192 TGAGCAGCCAACGCAGCCGCAGG - Exonic
1089590089 11:119534449-119534471 TGGGCAGGCACAACAGGCGAGGG - Intergenic
1091054184 11:132402946-132402968 TCGGCAGCCAGAGGAGCCTCAGG - Intergenic
1091230079 11:133982442-133982464 AGGGCAGGCAGGGCAGGCTCTGG + Intergenic
1091335478 11:134762765-134762787 TGGGGAGGAAGCGCAGCCCCCGG + Intergenic
1091355934 11:134937723-134937745 TGGGCAGCCAGCCCAGCCCCAGG - Intergenic
1202827267 11_KI270721v1_random:94398-94420 TGGGCAGGCAGGGGAGCCCAGGG + Intergenic
1091689728 12:2587845-2587867 GGGGCAGTCAGGGCAGCCTCAGG - Intronic
1091704012 12:2681561-2681583 TGGAGACGCAGAGCAGCAGCAGG - Intronic
1091713535 12:2760101-2760123 TGGAGACGCAGAGCAGCAGCAGG - Intergenic
1092240598 12:6833859-6833881 AGGGCAGGCAGAGCAGTAGCTGG - Intronic
1094485993 12:30926555-30926577 TGGGCTGGGAGAGCCGGCGCCGG + Intronic
1095857364 12:46874848-46874870 TGGCCAAGCAGAGCAGTGGCCGG - Intergenic
1096075363 12:48800530-48800552 AGGGCAGGCAGGGCAGCCCAGGG + Intergenic
1096489041 12:52003637-52003659 AGGGCAGGCAGAGCAGAGGGAGG + Intergenic
1096489574 12:52006493-52006515 AGGGCAGGGAGAGCGGCAGCGGG - Intergenic
1096622078 12:52871248-52871270 TGGACAGGCAGAACTGCCTCTGG - Intergenic
1097164782 12:57078248-57078270 TGGGCAGGCAGAGCAGCCGCGGG - Intronic
1098262658 12:68686788-68686810 TGGTCAGGCAAAGCGGCCGCAGG + Exonic
1099477339 12:83122788-83122810 TGGACAGACAGAGCAGCCTGTGG - Intronic
1100243117 12:92729541-92729563 TGGGGAGGCAGAGGTGCCGGTGG + Intronic
1102375756 12:112419384-112419406 GGGGCAGGTAGAGCCGCCGAGGG + Intronic
1102646844 12:114409189-114409211 TCGGCCGGCAGAGCTGCGGCGGG + Intergenic
1102695975 12:114799827-114799849 GGGGCTGGCAGAGCAGGCCCAGG - Intergenic
1102990993 12:117316146-117316168 TTGTCAGACAGTGCAGCCGCTGG + Intronic
1103716987 12:122950568-122950590 GGGGGAGGCAGGGCAGCCTCAGG + Intronic
1103725188 12:122994346-122994368 AGGGCAGGCAGGCCAGCGGCTGG - Intronic
1103925933 12:124423326-124423348 TTCGCAGGGAGAGCAGCGGCTGG + Intronic
1104429616 12:128705758-128705780 TGGCCAGGCAGAACACCCCCAGG - Exonic
1104475099 12:129064545-129064567 AGGGCAGGCAGGGCAGCTGGAGG + Intergenic
1104481344 12:129110844-129110866 TGGGTAGGGAGAGCACCGGCTGG - Intronic
1104850730 12:131872288-131872310 AAGGCAGGCAGAGCCGCCACAGG - Intergenic
1105606487 13:21930525-21930547 TGGGCAGGCAGAGCTGGCTGTGG + Intergenic
1106042635 13:26108406-26108428 GGGGCAGGCAGAGCAGGAGCTGG - Intergenic
1106083471 13:26519742-26519764 TTGGCCTGCAGAGCAGCCACTGG - Intergenic
1106246389 13:27953899-27953921 GGGGCAGCCGGAGCCGCCGCAGG - Intergenic
1106405787 13:29471719-29471741 TGGGCCTGCAGAGCAGAGGCTGG - Intronic
1107447076 13:40479351-40479373 CGGGCAGGCAGGGAAGGCGCTGG - Intergenic
1111960531 13:94805081-94805103 TGGGCAGCCCAAGCAGCCTCAGG + Intergenic
1113407749 13:110057208-110057230 TGGGCACACGGAGCAGCTGCGGG - Intergenic
1113892995 13:113746254-113746276 GGGGAACGCAGAGCAGCTGCTGG - Intergenic
1113917433 13:113882943-113882965 TGTGCAGGCAGAGCCCCCTCCGG - Intergenic
1114701062 14:24679065-24679087 CAGACAGTCAGAGCAGCCGCAGG - Intergenic
1116025049 14:39505112-39505134 TGGAGAGGCAGAGCTGCCGCTGG + Intergenic
1116222911 14:42111657-42111679 TGGGCAGTCAGAGCACCTGCTGG - Intergenic
1116786856 14:49297327-49297349 TGGGCCGGGAAAGCAGCTGCAGG + Intergenic
1119618861 14:76116734-76116756 TGGGCAGGCTGGGCAGCCAGAGG + Intergenic
1122124997 14:99574125-99574147 TGGGCAGGCACAGCAGAAGCAGG - Intronic
1122206135 14:100148936-100148958 TGGGCTGGCAGGGCTGCGGCGGG - Intronic
1122292885 14:100688851-100688873 CGGGTAGGCAGAGCAGGCGAGGG + Intergenic
1122717005 14:103701905-103701927 TGGCCTGGCAGAGCAGCTCCTGG - Intronic
1122871073 14:104639326-104639348 TGGGCATGGAGAGCAGGTGCGGG + Intergenic
1123092032 14:105746201-105746223 AGCCAAGGCAGAGCAGCCGCAGG - Intergenic
1123500852 15:20878977-20878999 GGGTCAGGCAGACCAGCCCCAGG + Intergenic
1123558104 15:21452672-21452694 GGGTCAGGCAGACCAGCCCCAGG + Intergenic
1123594332 15:21889953-21889975 GGGTCAGGCAGACCAGCCCCAGG + Intergenic
1124246725 15:28077548-28077570 TGGACATACAGAGCAGGCGCAGG + Intronic
1124949745 15:34306253-34306275 TGGGTAGGCAGTGCTGCAGCAGG + Intronic
1125786470 15:42322756-42322778 TGGGGAGGGAGAGAAGCCCCTGG + Intronic
1125919747 15:43518363-43518385 TGGAAATGCAGGGCAGCCGCTGG - Intronic
1128081605 15:64860504-64860526 GGGGCAGGCAGAGCATCCCATGG + Intronic
1128325232 15:66719746-66719768 TGGGCAGGGCGAGGGGCCGCAGG + Intronic
1129270033 15:74414747-74414769 TGGGCAAGGAGAGCAGGCCCAGG + Intronic
1129424775 15:75455206-75455228 TGGGTAGCCAGGGAAGCCGCGGG + Intronic
1130392937 15:83474869-83474891 TGGGTGGGCAGAGCAGCAGAAGG + Intronic
1130721114 15:86386342-86386364 TCTGTAGGCAGAGCAGCCCCAGG + Intronic
1131390514 15:92044245-92044267 TGGAGAGGAAGAGCAGACGCAGG - Intronic
1131872998 15:96779902-96779924 CGGTCAGGCAGGGCAGCTGCTGG + Intergenic
1132177871 15:99729541-99729563 GAGGCAGACAGAGCAGGCGCGGG - Exonic
1202966453 15_KI270727v1_random:179844-179866 GGGTCAGGCAGACCAGCCCCAGG + Intergenic
1132588154 16:715143-715165 GCGGCAGGCGGAGCGGCCGCGGG + Exonic
1132631994 16:922378-922400 ATGGCAGGCAGAGCGGCCACTGG + Intronic
1132781229 16:1626977-1626999 TGGCCAAGCAGAGCAGTGGCTGG - Intronic
1132804671 16:1769930-1769952 TGGGCAGGGAGAGCAGTCCAGGG - Exonic
1132897509 16:2236049-2236071 TGAGCAGGTGGAGCAGCAGCAGG + Exonic
1133165865 16:3946861-3946883 AGGGGAGGCAGTGCAGACGCAGG + Intergenic
1133398334 16:5466012-5466034 TGGGCAGGAAGAGGAGGTGCTGG + Intergenic
1133770507 16:8864894-8864916 CGGGCAGGCTGAGCAGGGGCTGG - Intronic
1134290707 16:12901541-12901563 AGGGCGGGCAGAGGAGGCGCGGG - Intergenic
1134507625 16:14821002-14821024 GTGGCAGGCAAAGCAGCAGCTGG + Intronic
1134512191 16:14857324-14857346 TGGGCTGACACAGCAGCCCCAGG + Intronic
1134689238 16:16180195-16180217 TGGGCAGGCAGCACAGCAGGAGG - Intronic
1134695323 16:16219764-16219786 GTGGCAGGCAAAGCAGCAGCTGG + Intronic
1134699827 16:16255827-16255849 TGGGCTGACACAGCAGCCCCAGG + Intronic
1134971998 16:18538835-18538857 TGGGCTGACACAGCAGCCCCAGG - Intronic
1134976509 16:18574922-18574944 GTGGCAGGCAAAGCAGCAGCTGG - Intergenic
1136452034 16:30358979-30359001 TTGGCAGGGAGAGCAGGCTCTGG + Intronic
1136471423 16:30483386-30483408 TGGGAAGGCAGAGGAGGTGCTGG + Intronic
1136568804 16:31084846-31084868 AGGGCAGGCAGAGGGGCCGCAGG + Exonic
1136930892 16:34417068-34417090 TCTGTAGGCAGAGCAGCCCCTGG + Intergenic
1136973681 16:34994740-34994762 TCTGTAGGCAGAGCAGCCCCTGG - Intergenic
1137009869 16:35311478-35311500 TGGGGAGGCAGAGCAGGGGGAGG - Intergenic
1137531807 16:49282593-49282615 GCGGCCGGCAGAGCAGTCGCTGG - Intergenic
1137786171 16:51139575-51139597 TGGCCTGGCAGAGCAGCTACAGG - Exonic
1138501460 16:57447556-57447578 CGGGCAGGCATCGCAGCTGCAGG - Exonic
1138543054 16:57699990-57700012 TGGGGTGGCAGAGCAGCCCTTGG - Intronic
1139954748 16:70687773-70687795 TGGGCAGACACAGCAGCCTCCGG + Exonic
1141688809 16:85585206-85585228 AGGGCAGGCAGGGCTGCAGCAGG - Intergenic
1141841866 16:86578823-86578845 GAGGCAGCTAGAGCAGCCGCGGG - Exonic
1142240643 16:88943224-88943246 TGGGCAGCCACAGCTGCCGCAGG - Intronic
1142320634 16:89380536-89380558 AGGGCACGAAGAGCAGCCCCAGG + Intronic
1142691006 17:1606076-1606098 TGGGGAGGCACAGCAGGCACTGG + Intronic
1142765261 17:2060842-2060864 AGGGCAGGAAGAGGAGCAGCAGG + Exonic
1143036939 17:4004832-4004854 CGAGCCGGGAGAGCAGCCGCGGG + Exonic
1143625930 17:8110100-8110122 TGGGGTGGCAGAGCGGCAGCTGG + Exonic
1143734449 17:8900677-8900699 GGGCCAGGCAGGGCAGCAGCTGG - Intronic
1143762799 17:9117043-9117065 TGGGCGGGGAGAGGAGCCTCTGG + Intronic
1144185179 17:12789885-12789907 TGGGCAGGTAGGTCACCCGCGGG + Exonic
1144838499 17:18171222-18171244 AGGGTAGGCAAAGCAGCCACAGG - Intronic
1145218429 17:21069428-21069450 GGGGCAGGAGGAGCAGCAGCAGG + Intergenic
1145758470 17:27409886-27409908 TGGGCAGCCAGCGCAGCCTAGGG - Intergenic
1146142466 17:30379472-30379494 TGAGCAGGCGGACCAGGCGCGGG - Exonic
1146619981 17:34389617-34389639 TGGGGAGGCAGAGCTGCTGTAGG + Intergenic
1147610938 17:41801484-41801506 TTAGCAGGCAGAGGAGCCCCAGG - Intergenic
1147659298 17:42108686-42108708 CGGCCAGGGAGAGCAGCTGCAGG + Intronic
1147721742 17:42543698-42543720 TCGGCAGGCAGTGCAGGAGCTGG + Exonic
1148170436 17:45514986-45515008 TGGGAAGGCAGAGCATCAGGAGG - Intergenic
1148170912 17:45518979-45519001 TGGGAAGGCAGAGCATCAGGAGG - Intergenic
1148365109 17:47049573-47049595 TGGGAAGGCAGAGCATCAGGAGG + Intergenic
1150011683 17:61510451-61510473 AGGAAAGGCAGAGCAGCAGCAGG - Intergenic
1150229379 17:63541785-63541807 TGGGAAGACAGAGAAGCCTCTGG + Intronic
1150504161 17:65681259-65681281 TGGGCAGGAAGAGCAGAGCCAGG - Intronic
1152760795 17:82106084-82106106 TGGGCAGGCTCAGCAGCAGCAGG - Intronic
1152902227 17:82949159-82949181 TGGGTTGGCACAGCAGCTGCGGG + Intronic
1153794375 18:8609405-8609427 GGGGCAGGAAGCGCAGGCGCGGG - Intergenic
1153958029 18:10114870-10114892 TGGGCATGCAGAGGAGCATCTGG + Intergenic
1156289341 18:35732305-35732327 TGTGCAGACAGAGCAGTCCCAGG + Intergenic
1156633481 18:38997241-38997263 TGGGCAGACAGAACAGCCTGTGG - Intergenic
1159998476 18:74992122-74992144 TGGGCACTCAGAACAGCAGCTGG - Intronic
1160214967 18:76920672-76920694 TGGACAGGCAGAAGAGCAGCAGG + Intronic
1160773274 19:843387-843409 GGGGATGGCAGAGCAGCCCCTGG - Intronic
1160857948 19:1225867-1225889 TGGGCAGGGTGGGCAGCCCCAGG + Intronic
1161077110 19:2291149-2291171 TGGCCAGGTGGCGCAGCCGCAGG + Exonic
1161463757 19:4415573-4415595 TTGGCAGGCAGAGTAGATGCTGG + Intronic
1161477203 19:4493485-4493507 TGGGCACGCCGGGCAGCTGCTGG - Intronic
1161772316 19:6237403-6237425 GGGGAATGCTGAGCAGCCGCTGG - Intronic
1161869165 19:6857159-6857181 TGGGCAGGCAGCGGAGCCAGGGG + Intronic
1162493282 19:11007904-11007926 GGAGGAGGAAGAGCAGCCGCAGG + Exonic
1162857059 19:13476859-13476881 GGGGCAGGCAGGGCAGAAGCTGG - Intronic
1163134127 19:15297001-15297023 TGGGCAGGCACCTCAGCCCCAGG + Intronic
1163268202 19:16234009-16234031 TGGGAGGGCAGAGCCGCCTCTGG - Intronic
1163491888 19:17621730-17621752 TGGGCAGGAAGGGCAGCTGGGGG - Intronic
1163723028 19:18907220-18907242 TGGGGGTGCAGAGCAGCAGCAGG + Intronic
1164528128 19:29026739-29026761 TGGGCATGGAGAGCAGCTGCTGG - Intergenic
1164885897 19:31778308-31778330 TGGAGAGCCAGGGCAGCCGCTGG - Intergenic
1165093183 19:33397086-33397108 AGGGCAGGCCCAGCAGCTGCAGG - Intronic
1165321944 19:35091002-35091024 GGAGCAGGCAGGGCGGCCGCGGG - Intergenic
1166656768 19:44618091-44618113 TGAGAAGGCAGAGCAGGTGCAGG - Intronic
1166670046 19:44704192-44704214 TGGCCAGGCATGGCATCCGCCGG + Exonic
1166996843 19:46723448-46723470 TGGGCAGTGTGAGCAGCTGCCGG - Intronic
1167270335 19:48502409-48502431 TGGGCGGGCCGGGGAGCCGCGGG - Intronic
1168335897 19:55597611-55597633 GGGGCAGGCAGAGCAGCGGTAGG + Exonic
925021105 2:568627-568649 CTGGCAGGCTGAGCAGCTGCTGG - Intergenic
925411759 2:3643620-3643642 AGGGCAGGCAGGGCAGGCGTGGG - Intronic
926399543 2:12482959-12482981 GAGGCAGGCAGATCAACCGCTGG + Intergenic
927879045 2:26677611-26677633 TGGGAAGGGAGAGCAGATGCTGG - Intergenic
927886249 2:26720691-26720713 GGGGCAGGGAGAGAAGCTGCTGG + Intronic
928904667 2:36356388-36356410 AGGGCAGGCAGACCAGCGCCCGG - Exonic
928907211 2:36380996-36381018 GGGGCAGGGAGAGCAGCGGGGGG - Intronic
929486804 2:42361789-42361811 TGGGCAGACTGAGCAACAGCAGG - Exonic
930251746 2:49042273-49042295 TGGGGTGGCAGACCAGCCACAGG - Intronic
932231282 2:70086551-70086573 TGGGCCCGAAAAGCAGCCGCGGG + Intergenic
933563891 2:83925299-83925321 TGGGCAGGCAGAGGAGGGTCTGG + Intergenic
933758378 2:85658353-85658375 TGGGAGGGGAGAGCAGCAGCTGG + Exonic
934052477 2:88222069-88222091 AGGGCAGACGGAGCAGCCACAGG + Intergenic
934129286 2:88931914-88931936 TGGGCAGGGAGAGCAGATGCTGG + Intergenic
935419139 2:102848662-102848684 CCGGCAGGCAGAGCGGCCCCCGG - Intergenic
936286951 2:111188186-111188208 TGTGCAGCCAGGGCAGCCTCTGG + Intergenic
936538840 2:113333748-113333770 TGGGAAGGAAGACCACCCGCTGG + Intergenic
937274312 2:120674304-120674326 TGGGCATGGAGGGCAGCTGCTGG + Intergenic
937398673 2:121562240-121562262 TGGGCAGGCAGTCCACCCTCAGG + Intronic
937438441 2:121897731-121897753 TGGCCAAGGAGAGCAGCCTCAGG - Intergenic
937955499 2:127419863-127419885 GGTGCAGGCAGAGCAGCAGCGGG + Intronic
938109458 2:128554157-128554179 TGGGCAGGCAGAGCTGCAGCAGG - Intergenic
938258381 2:129877844-129877866 GGGGCGGGCACAGCAGGCGCAGG + Intergenic
938323321 2:130380402-130380424 TGGGAGGGCAGAGCAGGCACAGG + Intergenic
938709923 2:133967452-133967474 AGAGAAGGCAGAGCAGTCGCAGG - Intergenic
946029715 2:216694529-216694551 GGGGGAGGCAGCGCAGCCCCTGG + Exonic
946268283 2:218568055-218568077 TGGGCGGGCTGAGTAGCAGCAGG + Intronic
946329919 2:219003136-219003158 TGGGCACGCAGAACGGCGGCAGG + Exonic
946531756 2:220578068-220578090 TAAGGAGGCAGAGCAGCCCCTGG - Intergenic
947745319 2:232504166-232504188 TGGGGAGGCAGAGCTGCCGCGGG + Intergenic
947767928 2:232649280-232649302 TGGGCACGCACAGCAGCAGATGG + Intronic
948540985 2:238691349-238691371 GGGGCAGGGACAGCAGCCACAGG - Intergenic
948600710 2:239106159-239106181 AGGACAGGCAGAGGAGCCGAGGG + Intronic
948640804 2:239375053-239375075 CGGGCAGGAAGGGCAGCCGCAGG + Intronic
948853325 2:240718808-240718830 TGGGCAGGCAGAGAGGCCTGGGG + Intronic
948933567 2:241148579-241148601 TGGGCAGGCATAGGAGGCTCTGG - Intronic
1169110644 20:3031062-3031084 TGGGCAGACAGAGCAGTGCCAGG + Intronic
1169199984 20:3704229-3704251 TGGGCAGACAGAGCATGCCCTGG - Intronic
1169268950 20:4184651-4184673 TGGGCAGGCATAGTAGATGCTGG - Intronic
1170019236 20:11817316-11817338 TGCCCAGGCAGAGCAACCTCTGG + Intergenic
1170913044 20:20593893-20593915 TGGGAAGGCAGACCAGCTGGTGG - Intronic
1171173790 20:23036449-23036471 AGCGCAGGCAGAGAACCCGCTGG - Exonic
1171320429 20:24239063-24239085 TGAGCAGGCAGAGCCACAGCAGG - Intergenic
1171412086 20:24954068-24954090 TGGGGAGGCAGAGCAGGCCTGGG - Intronic
1172230085 20:33330620-33330642 TGGGCAGGCAGGGCAGCTCCAGG - Intergenic
1173153059 20:40584289-40584311 TGGGCCAGCAGAGCAGCAGCTGG - Intergenic
1173247103 20:41344537-41344559 TTGGCAGGCAGAGGGGCAGCAGG + Intronic
1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG + Exonic
1173991902 20:47310040-47310062 GGAGCAGGTAAAGCAGCCGCTGG - Exonic
1174114243 20:48215872-48215894 TGGGCGGGCAGAGCTGCCTCAGG - Intergenic
1174135320 20:48375072-48375094 GGGGCAGGCAGAGGAGCCAGAGG - Intergenic
1174534471 20:51240126-51240148 TGGGCAGGCTGACCCACCGCAGG + Intergenic
1175437760 20:58966395-58966417 TGGGCAGGGAAAACAGCCACAGG - Intergenic
1175933374 20:62503816-62503838 TGGGCAGACAAAGCAGGCACCGG + Intergenic
1175947029 20:62563730-62563752 CAGGCAGGCAGGGCAGCCCCAGG + Intronic
1179709884 21:43207167-43207189 AGGGCAGGCACTGCAGCCTCTGG + Intergenic
1180062663 21:45393701-45393723 GGGGCTGGCATGGCAGCCGCAGG + Intergenic
1180159112 21:45991184-45991206 GAGGCAGGCAGAGGAGCAGCGGG + Intronic
1180581733 22:16845011-16845033 TGGGCAGGCAAAGCATCCTCAGG + Intergenic
1181038602 22:20181609-20181631 CAGGCTGGCAGAGCAGCCCCAGG + Intergenic
1181463454 22:23098481-23098503 TGGGCAGGGACAGCAGCCACTGG + Intronic
1181626210 22:24123981-24124003 TGGGCAGGCAGAGCCTCACCTGG - Intronic
1182067052 22:27438304-27438326 GGGGCAGCCAGGGCAGCAGCTGG + Intergenic
1182711471 22:32325905-32325927 TGGGCAGGCTGGGGAGCAGCAGG + Intergenic
1183587330 22:38760532-38760554 TGGGGAGTCAGAGAAGCTGCTGG + Intronic
1184238333 22:43198442-43198464 TGGGCAGGCAGAGCTGGGGTTGG - Exonic
1184362104 22:44024722-44024744 CCGGCAGGCAGAGCAGGCGCGGG - Intronic
1184438848 22:44496853-44496875 CGGGCAGGCAGGGCTGGCGCTGG + Exonic
1184554778 22:45227227-45227249 TGGGAAGGCAGAGCCGCAGAAGG - Intronic
1184569683 22:45314278-45314300 GCGGCAGGCAGAGCAGCTCCAGG - Intronic
1184754347 22:46507844-46507866 TGGGCAGTCAGAGGAGGCACTGG + Intronic
1184935682 22:47718699-47718721 TGGGCAGGGAGAGCAGGGGCAGG - Intergenic
950656582 3:14440618-14440640 GGGGCGGGCAGAGTAGCAGCAGG + Intronic
950706429 3:14785324-14785346 TGCACAGGCAGATCAGCCTCTGG - Intergenic
952840362 3:37640833-37640855 GAGGCAGGCAGAGCAGCCGATGG - Intronic
953607339 3:44420433-44420455 GGGGCATGCAGAGCAACGGCAGG - Intergenic
954320423 3:49828933-49828955 AGGGCAGGAAGAGCAGTCTCTGG + Exonic
956472318 3:69580132-69580154 TGGTCACCCAGAGCAGCAGCAGG + Intergenic
960948486 3:122983044-122983066 TGGCCAGGCAGGGCGGCTGCGGG + Intronic
961328318 3:126124602-126124624 TGGGCAGGCAGGGCCCCCTCTGG - Intronic
961461351 3:127052302-127052324 TCGGCAGGCAGAGCCGCCCGGGG - Intergenic
961518591 3:127454184-127454206 TTTGCAGGCACAGCAGCTGCAGG - Intergenic
962095142 3:132285397-132285419 TGGGCAGACACACCAGCGGCTGG - Exonic
962402000 3:135068171-135068193 TGGACAGACAGAGCAGCGGATGG - Intronic
964299283 3:155270632-155270654 TGGACAGGCAGAGCAGCGTGTGG + Intergenic
966746634 3:183283264-183283286 CAGGCAGGCTGACCAGCCGCTGG - Intronic
966794174 3:183698098-183698120 TCGGCAGGCAGCGCGGCAGCGGG + Intronic
968504090 4:964039-964061 TTGGCAGGCAGAGCCGCCTGCGG + Intronic
968578154 4:1377459-1377481 TGGGCAGGCTGCTCAGCGGCCGG + Intronic
968897632 4:3414000-3414022 TGGGCGGGCAGAGCAGTCACTGG + Intronic
970324491 4:14909288-14909310 TGGGCAGAAACAGCAGCAGCAGG - Intergenic
973334131 4:48938669-48938691 TGGGCAGGCAGGGTAGACGGGGG + Intergenic
973695495 4:53486489-53486511 AGGGCAGGCAGATCAGCCTTGGG - Intronic
973887714 4:55339678-55339700 GGGGCAGGCAAAGCACCCCCTGG + Intergenic
974028062 4:56751462-56751484 TGGGCCCGCAGAGCAGACGATGG - Intergenic
974303261 4:60097951-60097973 TGGGCAGGCACACAAGCAGCTGG + Intergenic
975367019 4:73541340-73541362 AGGGCAGGGAGAGCAGTCGATGG + Intergenic
975683308 4:76897155-76897177 TGGGCAGGCAGAGCCCGTGCCGG + Exonic
977206440 4:94169705-94169727 TGCCCAGGCAGAGGAGGCGCCGG - Intergenic
978532584 4:109729986-109730008 CGGGCAGGCAGCGCCGTCGCGGG + Exonic
979832997 4:125323914-125323936 TGGGCAGGCAGAGAGTCAGCGGG + Intronic
980555542 4:134398816-134398838 TGGGCAGTCAGTGGAGCAGCTGG + Intergenic
980999486 4:139814812-139814834 TGGGAAGGAAGAGCAGTTGCTGG - Intronic
981178251 4:141707972-141707994 TGGAGAGGCAGAGCTGCTGCAGG + Intronic
981748763 4:148073991-148074013 TGGGCAGCTAGAGCAGGCTCAGG + Intergenic
984680344 4:182601064-182601086 TCGGCGGGCAAAGCAGCCGGCGG - Exonic
985017425 4:185651112-185651134 TGGGCAGGGAGAGGAGCCCTGGG + Intronic
985127964 4:186714135-186714157 TGGGCAGCCAGGGCAGAAGCTGG + Intronic
985646899 5:1089209-1089231 TGGGCAGGCAAAGCGGCCGTGGG + Intronic
985714553 5:1448101-1448123 TGGGCAGGAAGTGCAGAGGCAGG - Intergenic
988614925 5:32766014-32766036 TGGTCTGGGAGAGCAGCCCCTGG + Intronic
990983917 5:61625166-61625188 AGGGCAGGCAGAAGAGCCGTCGG + Intergenic
991402916 5:66273010-66273032 TGGGCTGTAAGAGCAGCAGCAGG - Intergenic
992481670 5:77157848-77157870 TGGGAAGCCAGAGCACCCGTGGG - Intergenic
996090465 5:119346104-119346126 TGGGCTGGCAGAGAAGTCACTGG + Intronic
996615819 5:125440547-125440569 TGGACAGGCAGAGCAGCATGTGG + Intergenic
996978575 5:129461792-129461814 TGGGCAAGGAGAGGAGCAGCAGG - Intronic
998478195 5:142439181-142439203 TGGGCAGGCAGAGGAGGAGCAGG + Intergenic
998829622 5:146143419-146143441 TGGACAGGCAGAGTCTCCGCTGG - Exonic
999077269 5:148808004-148808026 TGGGTAAACAGAGCAGCCACGGG - Intergenic
999124706 5:149238694-149238716 TGGGCAGGCATTCCAGCTGCTGG + Intronic
999194619 5:149773680-149773702 ATGGGAGGCAGAGCGGCCGCGGG + Intronic
1001100934 5:168813788-168813810 TGGGCAGGCAGAGCCCTCACAGG + Intronic
1001639851 5:173236505-173236527 CGGGCAGGCAGAGCGGGCCCAGG + Intergenic
1001753364 5:174147989-174148011 TGGGCAGGGAGGGCAGGGGCAGG + Intronic
1002500679 5:179645376-179645398 TGAGCAGGCAGAGGAGACCCTGG - Intergenic
1002576348 5:180176275-180176297 CTGGCAGGCAGAGCAGCCGTGGG + Intronic
1004229015 6:13814357-13814379 CGGGCAAGAAGAGAAGCCGCTGG + Exonic
1007247081 6:40470674-40470696 TGGGAAGGCAGAGCAGCCAGTGG + Intronic
1007386661 6:41524723-41524745 GTGGCAGGCAGAGCAGGGGCAGG + Intergenic
1007417995 6:41703251-41703273 CGGGCATGCAGAGCAGCTTCTGG + Intronic
1007430682 6:41774952-41774974 TGAGCAGGCAGAGCAGGCAGAGG - Intronic
1007459518 6:42007935-42007957 TGAGCCGGCAGAGCAGCTGGCGG + Intronic
1007826696 6:44606157-44606179 AGGGCAGGCAGAGGAGGTGCAGG + Intergenic
1007833211 6:44654644-44654666 GTGACAGGCAGAGCAGCGGCAGG - Intergenic
1011620554 6:89238207-89238229 TGGACAGACAGAGCAGCCTGTGG - Intergenic
1014164206 6:118205094-118205116 AGGGCAGGCAGAGCTGCATCAGG - Intronic
1015830794 6:137366385-137366407 TGGGCAGGGACAGCAACCCCAGG - Intergenic
1019119503 6:169792035-169792057 TGGGGAGGGAGAGAATCCGCCGG - Intergenic
1019463794 7:1175385-1175407 AGGCCAGGCAGCCCAGCCGCAGG - Intergenic
1019475615 7:1242736-1242758 CGGGCACACAGAGAAGCCGCGGG + Intergenic
1019554801 7:1623925-1623947 TGCACAGGCAGAGCTGCCTCTGG - Intergenic
1019599746 7:1875209-1875231 GGGGCGGGCAGGGCAGCAGCAGG - Intronic
1020331397 7:7020571-7020593 GGGGCAGGCAGAGCTGGAGCAGG + Intergenic
1020840620 7:13213118-13213140 TTGGGAGGCAGAGCAGTCCCTGG - Intergenic
1021698257 7:23294065-23294087 AGGGCAGGGAGAGCAGCCTGGGG - Intergenic
1022040469 7:26576557-26576579 TGGGAAGGAAGAGCAGCCCCAGG + Intergenic
1022518472 7:30990187-30990209 GGGGCAGCCAAAGCAGCAGCTGG - Intronic
1023022431 7:36022115-36022137 AAAGCAGGCAGAGCAGCCCCTGG - Intergenic
1023943356 7:44784497-44784519 AGGGAAGGGAGAGCAGCAGCAGG - Intergenic
1025212143 7:57025878-57025900 TGGCCAGGAAGAGCACCCGTGGG - Intergenic
1025659811 7:63550950-63550972 TGGCCAGGAAGAGCACCCGTGGG + Intergenic
1026802867 7:73410947-73410969 TGGGCAGGCAGATCAGTGCCAGG - Intergenic
1029253861 7:99255691-99255713 TGGGCGGGCAGAGCTGGCACAGG + Intergenic
1029501598 7:100934019-100934041 TGGGCAGGCCGAATAGCAGCAGG - Intergenic
1032087310 7:128890953-128890975 CGGGCGGGCAGGGCAGCCGCTGG + Exonic
1032188723 7:129750261-129750283 GGGGCAGGCTGAGCAGATGCAGG + Intronic
1032504144 7:132423172-132423194 TGGGAATGCAGAGCCTCCGCAGG - Intronic
1033305005 7:140218785-140218807 TGGCCAGGAAGAGGAGCTGCTGG + Intergenic
1033421607 7:141209057-141209079 TTGGCCAGCAGAGCAGCAGCTGG + Intronic
1034438726 7:151076045-151076067 GGGCCAGGCAGAGCAGCTGCAGG - Exonic
1035449125 7:158964058-158964080 TAGGCAGGAAGAGCAGCAGAAGG - Intergenic
1038265784 8:26039395-26039417 GGGGCAGGGAGAGGACCCGCTGG - Intronic
1039793043 8:40890925-40890947 GGGGTGGGCAGAGGAGCCGCTGG - Intronic
1040627028 8:49160874-49160896 TGGGCAAGTACAGCAGCCACAGG - Intergenic
1041838725 8:62246058-62246080 TGGGAAGGGAGAGCAGATGCAGG - Intergenic
1042159805 8:65881364-65881386 GTGGCAGGCAGGGCAGCCGCTGG - Intergenic
1042321485 8:67479943-67479965 TGGTCAAGCAGAACAGCCCCCGG + Intronic
1042937351 8:74073251-74073273 GGGGAAGGCAGAGCAGTTGCAGG + Intergenic
1043980039 8:86627319-86627341 TGGGCAGGCAGAGCAACAAAAGG - Intronic
1045146047 8:99346023-99346045 TGGGCAGGCAGAGCAGTGGTTGG + Intronic
1049201754 8:141343766-141343788 TGGGCAGGCCGGGCAGCAGCGGG + Intergenic
1049277339 8:141726388-141726410 TGGGTAGGGAGAGGAGCAGCCGG - Intergenic
1049299544 8:141862313-141862335 AGGGCACACAGAGCAGCCGACGG - Intergenic
1049300895 8:141868918-141868940 TGTGCCGGCAGTGCAGCAGCTGG + Intergenic
1049601397 8:143509452-143509474 TGGGCAGTCAGGGCACCCACTGG + Intronic
1049655370 8:143794738-143794760 TGGGCAGCCCCAGCAGCAGCAGG + Intronic
1049748371 8:144272513-144272535 GGGGCTGGCAGAGCAGCCTGTGG - Intronic
1050629294 9:7541864-7541886 TGGGCAGGCAGCGTAGGTGCTGG - Intergenic
1052840522 9:33288782-33288804 TGGGGAGGCAGAGGAGAGGCAGG - Intergenic
1052999749 9:34571412-34571434 TGGGCAGGCAGAAGAGCAGGCGG + Intronic
1053411882 9:37921064-37921086 TGGGCAGGCAGAGGACAGGCTGG - Intronic
1056578078 9:87870877-87870899 AGGGAGAGCAGAGCAGCCGCAGG + Intergenic
1057213966 9:93218135-93218157 TGTGGGGGCAGGGCAGCCGCAGG + Intronic
1057668581 9:97067582-97067604 TGGGAAGGAAGAGCCGCGGCGGG + Intergenic
1057705454 9:97392133-97392155 TGGACAGGCAGGGCAGGCACAGG - Intergenic
1060192032 9:121599502-121599524 TGGGCAGGCCGGGTGGCCGCGGG + Intronic
1060484987 9:124041121-124041143 TGGGGCTGCAGAGCCGCCGCAGG + Intergenic
1060527905 9:124330803-124330825 TGGGCAGGCAGGGCAGGCGTGGG + Intronic
1060584402 9:124777173-124777195 GGGGCAGGCAGAGCGGGCGAAGG + Intronic
1060828009 9:126697289-126697311 TGGGCAGGGAGGGCAGCCCCAGG + Exonic
1060999646 9:127896012-127896034 TGGGAAGGCAGAGCTGACCCTGG + Intronic
1061079954 9:128364000-128364022 AGGGCAGGCAGCGAAGCTGCAGG + Intergenic
1061295564 9:129675089-129675111 AGGCCGGGCAGAGCTGCCGCAGG + Intronic
1061381874 9:130263754-130263776 TAGGCAGCGAGAGCAGCAGCGGG - Intergenic
1061811286 9:133163877-133163899 AGGGCAGGCAGCGGGGCCGCGGG + Exonic
1061853333 9:133428748-133428770 TGAGCAGGCTCAGCAGCTGCCGG - Exonic
1061873848 9:133534435-133534457 TGTCCAGACGGAGCAGCCGCTGG - Intronic
1061874956 9:133539045-133539067 AGGGAAGGCAGAGCAGCTGGGGG + Intronic
1062087465 9:134656181-134656203 CGGGCAGGACGAGGAGCCGCAGG - Intronic
1062269983 9:135703940-135703962 ACTGCAGGCAGAGCAGCCGCCGG + Intronic
1062354044 9:136153528-136153550 AAGACAGGCAGGGCAGCCGCTGG - Intergenic
1203787614 EBV:136653-136675 TGGGGAGGTAAAGTAGCCGCCGG - Intergenic
1187827275 X:23344642-23344664 TAGGCAGGCAGAGCTGCGGATGG + Intronic
1189333456 X:40156387-40156409 TGGGGCGGCACAGCAGCGGCAGG + Intronic
1192013414 X:67299950-67299972 TGGGTGGGCAGAGCTGCCCCTGG - Intergenic
1192177453 X:68894862-68894884 TGAGGAAGCAGAACAGCCGCCGG - Intergenic
1192332768 X:70190973-70190995 TGGGCAGGCAGGACAGGCCCGGG - Intronic
1193603245 X:83534568-83534590 TGGGCAGGCAGAGAGGCAGTGGG + Intergenic
1195114980 X:101688225-101688247 AGAGCAGGCACAGCAGCAGCAGG - Intergenic
1196937807 X:120746912-120746934 AGGGCAGCAAGAGCAGCCCCTGG + Intergenic
1197521314 X:127500958-127500980 TGGGGAGGCTGAGAAGCCCCCGG + Intergenic
1197754103 X:129983010-129983032 GGGGCAAGCCGAGCGGCCGCAGG - Intronic
1200118644 X:153780378-153780400 TGGAGAGGAAGAGCAGGCGCTGG + Intronic