ID: 1097166370

View in Genome Browser
Species Human (GRCh38)
Location 12:57088681-57088703
Sequence CGCCGGCGGGGCGCTCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097166359_1097166370 16 Left 1097166359 12:57088642-57088664 CCTCTCTCAGCTCGGAGGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1097166370 12:57088681-57088703 CGCCGGCGGGGCGCTCACGTGGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097166370 Original CRISPR CGCCGGCGGGGCGCTCACGT GGG Intergenic
904672984 1:32179949-32179971 CGCGCGCGGGGGGCGCACGTGGG + Intronic
1068762977 10:60733245-60733267 GGGCGGCGCGGCGCTCACCTGGG + Intronic
1074977708 10:118594890-118594912 CGCCTGCGTGCCGCTCACGCTGG - Exonic
1076719833 10:132388197-132388219 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719849 10:132388236-132388258 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719892 10:132388332-132388354 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719987 10:132388540-132388562 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1078057577 11:8019773-8019795 GGCCGGCGGGGCGCAGACGCCGG - Intronic
1083440274 11:62671698-62671720 CGGCTGCGGGGAGCTCCCGTGGG + Exonic
1083707528 11:64526474-64526496 CACCGGCTGGGCGCTCCCGTGGG + Intergenic
1090029651 11:123195810-123195832 CGACGGCGGGGCGCGGAAGTGGG + Intergenic
1097166370 12:57088681-57088703 CGCCGGCGGGGCGCTCACGTGGG + Intergenic
1103604877 12:122079008-122079030 CGGTGGCGCGGCGCTCGCGTGGG - Exonic
1105538968 13:21298130-21298152 CGGAGGCGGGGCCGTCACGTGGG + Intergenic
1112494710 13:99895770-99895792 CGCCGCCCGGGCGCTAACGACGG - Exonic
1114602777 14:23969789-23969811 CGCCGACGGGCCTCTCACGCCGG + Intergenic
1115576252 14:34714697-34714719 AGCGGGCGGGGCGGTCACGTGGG + Intronic
1121417481 14:93788969-93788991 CGCCGGCAGGGAGCTCCCGCTGG + Intergenic
1122143329 14:99675138-99675160 CCTCGGCGGGGCGCCCGCGTGGG - Exonic
1122630423 14:103105055-103105077 CGCCTGCGAGGAGCTCAGGTAGG + Exonic
1122898712 14:104773233-104773255 CGCAGGTGGGGCGCACACCTCGG + Exonic
1129334364 15:74843426-74843448 CGCCGCCCGCGCCCTCACGTGGG - Intergenic
1142509769 17:386094-386116 GGCCGGCGGGGCGCACAGGGAGG - Intronic
1149712428 17:58755801-58755823 CGCCCCCGGGCCGCGCACGTCGG + Intergenic
1151612086 17:75182796-75182818 GGCCGGCGGCGAGCTCACCTTGG + Intergenic
1158954761 18:62526829-62526851 GGCCGGCGCGCCGGTCACGTGGG - Intronic
1160930467 19:1567651-1567673 CGGCGGCGGGGGACTCGCGTTGG + Exonic
1163085918 19:14979709-14979731 GGCCGGCCCTGCGCTCACGTGGG + Intronic
1163138578 19:15331748-15331770 CTCGGCCGCGGCGCTCACGTGGG - Intronic
1163442546 19:17329053-17329075 CTCCGGCGGGGCGCCCAGGGAGG - Intronic
1163453039 19:17390512-17390534 GGCCGGCGCGGCGCGCACGAGGG - Intergenic
1165233848 19:34404798-34404820 CACCGGCGGTGCGCGCAGGTAGG + Exonic
1167780307 19:51594642-51594664 CGCGGGATGGGCGCTCACCTGGG - Intergenic
1168078510 19:53993014-53993036 CGCCAGCGTGGCGCCCACGGCGG - Exonic
926301905 2:11610924-11610946 CGCCAGCCGGGCCCGCACGTGGG - Exonic
927843666 2:26460629-26460651 GGCCGGCAGGGCACTCACTTGGG + Exonic
938072965 2:128318019-128318041 CGCCGCCCGGGCGCTCACCTGGG + Exonic
946019859 2:216633613-216633635 CGGCGGCGGGGCGCGCGCGGAGG + Exonic
1171779671 20:29408071-29408093 CGACGGCGGGACGCTCAGGGAGG + Intergenic
1180843629 22:18970413-18970435 GGCGGGCGGGGCCCTCACCTGGG - Intergenic
1181514357 22:23402647-23402669 GGTGGGCGGGGCGCTCACCTGGG + Intergenic
1182261020 22:29073163-29073185 CTCCGCCGCGGCGCTCACGCTGG + Exonic
1182586339 22:31346148-31346170 CGGCGGCGGGGCGCGCACGGGGG + Exonic
949896011 3:8768125-8768147 CGGCGGCGCGGCGCTGGCGTTGG + Exonic
951080128 3:18443964-18443986 GGGCGCCGGGGCGCTCAAGTTGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
967795375 3:193593353-193593375 CGCCGGCGGGGAGGTCACGCAGG - Exonic
968505958 4:971650-971672 AGCCGGCGGGGTGCTCAGGAGGG + Intronic
968514944 4:1011950-1011972 CGCGCGCGGGGGGCTCACCTCGG - Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
976649875 4:87422890-87422912 CGCCCTCGGGGCGCTCATGGCGG + Exonic
983550269 4:169010349-169010371 CGCCGGCGGGGAGCTCTCGTCGG - Intergenic
987258435 5:16180004-16180026 GGCCGGCCCCGCGCTCACGTCGG + Intronic
1003871845 6:10410246-10410268 CAGCGGCGGGGCGCTCGTGTAGG + Exonic
1008379206 6:50823474-50823496 CAGCGGCGGGGCGCTCGAGTAGG - Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1016386757 6:143537070-143537092 CGCCGGCGGGGCGGGCGCCTCGG - Intronic
1019418214 7:936998-937020 CCCCGGCCGGGGGCTCACTTGGG - Intronic
1019432564 7:1005964-1005986 CGCCTGCTGGGTGTTCACGTTGG - Intronic
1033683740 7:143620782-143620804 CGTAGGCGGGGCTCTCTCGTAGG - Intergenic
1033700872 7:143836856-143836878 CGTAGGCGGGGCTCTCTCGTAGG + Intergenic
1061961698 9:133992057-133992079 CGCCCGCCGGGCGCTCACCTGGG + Exonic
1189821585 X:44873797-44873819 CGGCGGCGGGGCGGGCACCTCGG + Intronic
1192260758 X:69504813-69504835 CGGCGGCGGGGCCCGCACGGCGG + Intergenic
1192344496 X:70290007-70290029 CGAGGGCGGAGCGCGCACGTCGG - Intronic
1200217586 X:154374825-154374847 CGCCGGCGGTGAGCTCATCTCGG - Intergenic