ID: 1097171974

View in Genome Browser
Species Human (GRCh38)
Location 12:57120384-57120406
Sequence GCAAATTATGCCAGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4277
Summary {0: 1, 1: 1, 2: 38, 3: 517, 4: 3720}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097171974 Original CRISPR GCAAATTATGCCAGGCACGG TGG (reversed) Intronic