ID: 1097172311

View in Genome Browser
Species Human (GRCh38)
Location 12:57123461-57123483
Sequence CTGTGGTGGCATGCATCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 5, 2: 16, 3: 90, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097172311_1097172316 4 Left 1097172311 12:57123461-57123483 CCTACAGATGCATGCCACCACAG 0: 1
1: 5
2: 16
3: 90
4: 378
Right 1097172316 12:57123488-57123510 GGGATTTTTAAAAACTCTCCAGG 0: 1
1: 3
2: 23
3: 123
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097172311 Original CRISPR CTGTGGTGGCATGCATCTGT AGG (reversed) Intronic
900575397 1:3380040-3380062 CTGTGTTGGGATGAATGTGTTGG - Intronic
901253901 1:7804537-7804559 ATGTGTTGGCAGGCACCTGTGGG - Intronic
901299212 1:8186837-8186859 GAGTGGTGGCGTGCACCTGTAGG + Intergenic
901316508 1:8313639-8313661 GCGTGGTGGCGTGCACCTGTAGG - Intergenic
902424048 1:16305247-16305269 GCGTGGTGGCATGCACCTGTGGG + Intronic
903200744 1:21736126-21736148 GTGTGGTGGCACTTATCTGTAGG + Intronic
904097828 1:27995271-27995293 GTATGGTGGCATGCGCCTGTGGG + Intronic
905759186 1:40539357-40539379 GTGTGGTGGCATGTGCCTGTAGG + Intronic
906863200 1:49384452-49384474 GTGTGGTGGTGTGCACCTGTAGG + Intronic
907074182 1:51563943-51563965 GTGTGGTGGCATGCACCTGGTGG + Intergenic
907496530 1:54848915-54848937 GTATGGTGGCAAGTATCTGTAGG - Intergenic
908076280 1:60522861-60522883 CTGTTGTGGGAGGGATCTGTTGG - Intergenic
908705423 1:66948758-66948780 GCATGGTGGCATGCACCTGTAGG + Intronic
909244101 1:73255078-73255100 GCGTGGTGGCAAGCATCTGTAGG - Intergenic
909687273 1:78364341-78364363 GCGTGGTGGCACGCACCTGTAGG - Intronic
909896735 1:81080658-81080680 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
910667768 1:89742783-89742805 CTATGTTGGCATGAATCTGCTGG + Intronic
911173677 1:94796823-94796845 GTGTGGTGGCATGCACTTGTAGG + Intergenic
911406590 1:97448083-97448105 GCATGGTGGCATGCACCTGTAGG + Intronic
912399626 1:109379002-109379024 GTGTGGTGGCACACACCTGTAGG + Intronic
912445997 1:109737214-109737236 CTGTTCTGGTATGCATCTGTTGG - Intronic
915474733 1:156146987-156147009 CTGAGGTGGCACGCATATGGGGG + Intergenic
916525004 1:165601267-165601289 CTGTGGTGGCAAGCTGCTGTGGG - Intergenic
917417863 1:174830033-174830055 ATGTGGTAGCATTCAACTGTTGG + Intronic
917700307 1:177573916-177573938 CTGTGGTGGGAGGCATAGGTGGG - Intergenic
917823288 1:178789043-178789065 GCGTGGTGGCATGCACCTGGAGG - Intronic
918222092 1:182444424-182444446 GTGGGATGGCATGCATGTGTTGG + Intergenic
918479819 1:184966418-184966440 CTGTGGATGCATGCATCTGGTGG - Intronic
919039974 1:192373533-192373555 GTGTGGTGGCAAGCACCTTTAGG - Intergenic
919977839 1:202624193-202624215 ATGTGGTGGTATGTATGTGTAGG + Intronic
920666160 1:207964132-207964154 CTGGGGTGGCAGGCGTATGTTGG - Intergenic
920978016 1:210804101-210804123 TGGTGTTGGCATACATCTGTTGG + Exonic
921078633 1:211721002-211721024 GTGTGGTGGCGGGCACCTGTAGG - Intergenic
921301506 1:213755476-213755498 CTGTGGAGGCATGCAAATGTGGG - Intergenic
921874701 1:220181391-220181413 CTGTGTATGCATGCATGTGTAGG + Intronic
922762733 1:228142605-228142627 CTGTGCTGGGTTGCATCTGTTGG + Intronic
923669578 1:236029036-236029058 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1062873134 10:924102-924124 GTGTGGTGGCATGCACCCATGGG + Intronic
1063241967 10:4179789-4179811 CTGTGTTCACATACATCTGTAGG + Intergenic
1063455743 10:6181657-6181679 GTGTGGTGGGACACATCTGTGGG + Intronic
1064055097 10:12090619-12090641 GTATGATGGCATGCACCTGTAGG - Intronic
1066117827 10:32256020-32256042 GTGTGGTGACATGCAACTGTGGG - Intergenic
1066419284 10:35249069-35249091 GAGTGGTGGCATGCACCTGTTGG - Intronic
1067202577 10:44186062-44186084 TTGTGGTGGTATTTATCTGTGGG + Intergenic
1069262986 10:66422608-66422630 CTCTTCTGGCATGCAACTGTAGG + Intronic
1069382310 10:67853423-67853445 GCCTGGTGGCATGCATCTGTAGG + Intergenic
1069401023 10:68046830-68046852 GCGTGGTGGCACACATCTGTGGG + Intronic
1069504055 10:68980858-68980880 ATGTAGTGGCATGCACCTGTAGG + Intronic
1069691938 10:70359413-70359435 GTGTGGTGGCATGCACCTGTGGG + Intronic
1070050158 10:72880988-72881010 GTGTGGTGTCGTGCACCTGTAGG + Intronic
1070629492 10:78074858-78074880 GCGTGGTGGCATGCACCTGTAGG - Intergenic
1071097375 10:81993483-81993505 TTGTGGTGGCATGCATCTGTAGG - Intronic
1072036296 10:91565825-91565847 CTGAGTTGGCTGGCATCTGTGGG + Intergenic
1072470109 10:95705958-95705980 GTGTGATGGCATGCACCTATAGG + Intergenic
1073305283 10:102498601-102498623 GCTTGGTGGCATGCACCTGTAGG - Intronic
1073370218 10:102981527-102981549 GTGTGGTGGCATGCACCTGTGGG - Intronic
1074292002 10:112144668-112144690 GTGTGGTGGCACGCGCCTGTAGG + Intergenic
1074804117 10:117030025-117030047 GCGTGATGGCATGCACCTGTAGG - Intronic
1077079717 11:719880-719902 CTGCCTTGGCAGGCATCTGTAGG - Intronic
1079695865 11:23481979-23482001 GCATGGTGGCATGCACCTGTAGG + Intergenic
1080041005 11:27759449-27759471 TTGTGGGGGAATGCATGTGTGGG + Intergenic
1080916920 11:36669159-36669181 CCGGGATGGCATGCATCTTTAGG - Intergenic
1082766604 11:57173574-57173596 GCATGGTGGCATGCACCTGTGGG - Intergenic
1083977392 11:66134403-66134425 GTGTAGTGGCAGGCACCTGTAGG - Intronic
1084080036 11:66816698-66816720 GTGCACTGGCATGCATCTGTAGG - Intronic
1084706414 11:70818699-70818721 CTCTGGTGGGAAGCGTCTGTGGG + Intronic
1084913161 11:72407783-72407805 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1085059627 11:73433048-73433070 GCGTGGTGGCACGCACCTGTAGG - Intronic
1085158359 11:74317687-74317709 GTGTGGTGGCATGGGCCTGTGGG - Intergenic
1086391174 11:86365313-86365335 CATTGGTGGCATGCATCTGTAGG - Intergenic
1086903573 11:92394331-92394353 GGGTGGTGGCATGCACCTGTAGG + Intronic
1087201745 11:95352478-95352500 CTTTGGTTGCCTGTATCTGTGGG - Intergenic
1088463478 11:110108084-110108106 GTGTGTTGGCACGCATCTGTGGG - Intronic
1089125119 11:116171479-116171501 TTGTGGTGGCATGTGTGTGTTGG + Intergenic
1089723970 11:120456857-120456879 GTGTGGTGGCACGCAACTGTAGG + Intronic
1090733500 11:129591555-129591577 CAGAGGAGGCCTGCATCTGTGGG - Intergenic
1090826513 11:130390928-130390950 ATGTGGTGGCATGCACCTGTAGG - Intergenic
1090856865 11:130617462-130617484 CTGTGGTTTCAGGCATCTGCTGG + Intergenic
1091226653 11:133960770-133960792 ATGTGGTGGCATGTGCCTGTAGG - Intergenic
1091422388 12:353202-353224 GCGTGGTGGCATACATCTGTAGG + Intronic
1091713489 12:2759802-2759824 CTGTGGAGAGATGTATCTGTGGG - Intergenic
1094662499 12:32483850-32483872 CTGTGGTGGTGTCCATCTGAGGG - Intronic
1096325228 12:50654491-50654513 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1097172311 12:57123461-57123483 CTGTGGTGGCATGCATCTGTAGG - Intronic
1097597204 12:61648716-61648738 CTGTAGTGGCACACATCTGTAGG + Intergenic
1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG + Intergenic
1100967777 12:100031591-100031613 GTGTGGTGGCACACACCTGTAGG + Intronic
1101064650 12:101007212-101007234 GTGTGATGGCATGCGCCTGTAGG + Intronic
1102808939 12:115807140-115807162 GTGTGGTGGCATGCATCTGTGGG - Intergenic
1103786944 12:123439756-123439778 GTATGGTGGCAAGCACCTGTAGG - Intergenic
1104460231 12:128949797-128949819 GTGTGCATGCATGCATCTGTAGG - Intronic
1104580261 12:130006347-130006369 CTCTGGTGGCCTTCAGCTGTCGG - Intergenic
1105748610 13:23400557-23400579 GTGTGGTGGCGGGCACCTGTAGG - Intronic
1105763815 13:23537956-23537978 GTGTGGTGGCGGGCACCTGTAGG + Intergenic
1105903751 13:24782536-24782558 GTGTGGTGGCTTACACCTGTAGG + Intronic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1106547206 13:30741242-30741264 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1106809498 13:33346232-33346254 CTGGGGTGGCAGTCATCTGAAGG - Intronic
1108073457 13:46653690-46653712 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1108102441 13:46970917-46970939 GTGTGGTGGCATGCACCTGTAGG + Intergenic
1109325198 13:60859105-60859127 GGGTGGTGGCACGCACCTGTAGG - Intergenic
1109788696 13:67218242-67218264 CTGTGATGGCATTCATCTGGAGG + Intronic
1110115078 13:71804178-71804200 CCGTGGTGGCATGCACTTGTAGG + Intronic
1111885736 13:94018426-94018448 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1112672067 13:101652278-101652300 GTGTGGTGGCATGCACCTGCAGG - Intronic
1112867688 13:103926768-103926790 ACATGGTGGCATGCATCTTTAGG + Intergenic
1112893643 13:104270194-104270216 GTGTAGTGGCATGCACCTGTAGG - Intergenic
1113143553 13:107182411-107182433 GCGTGGTGGCATTCACCTGTAGG - Intronic
1114068218 14:19084721-19084743 GTGTGGTGGTACGCACCTGTGGG - Intergenic
1114094045 14:19315304-19315326 GTGTGGTGGTACGCACCTGTGGG + Intergenic
1114444988 14:22781537-22781559 CTGGGGTGGCCTGGAGCTGTGGG - Intronic
1115106744 14:29770835-29770857 GTGTGGTGGCACGCGTCCGTGGG + Intronic
1116271753 14:42779393-42779415 GTGTGGTTGGATGCATCTGGTGG - Intergenic
1116940120 14:50783185-50783207 GCGTGGTAGCAGGCATCTGTAGG - Intronic
1117112819 14:52475979-52476001 CTGTGGTGTCAACCATCTGTGGG - Intronic
1117659178 14:57986391-57986413 GTGTGGTAGTATGCACCTGTAGG + Intergenic
1118632297 14:67716743-67716765 ATGTGGTGGCAGGCACCTGTGGG + Intronic
1119634197 14:76260889-76260911 GCCTGGTGGCATGCACCTGTAGG + Intergenic
1119668822 14:76503471-76503493 GCATGGTGGCACGCATCTGTAGG + Intergenic
1120544597 14:85795250-85795272 GTGTGGGGGCATGGATGTGTGGG + Intergenic
1121110945 14:91312544-91312566 GTGTGGTAGTGTGCATCTGTAGG + Intronic
1121772247 14:96557014-96557036 AAATGGTGGCATGCACCTGTGGG - Intronic
1121780618 14:96619557-96619579 GTGTGGTGGCGTGCACCTGTGGG + Intergenic
1122158709 14:99767461-99767483 GTGTGGTGGCACGCACCTGTAGG + Intronic
1122596507 14:102896932-102896954 TGGTGGTGGCATGTACCTGTAGG + Intronic
1123427270 15:20183028-20183050 CTGCTGTGGCATGGATCAGTAGG + Intergenic
1123536507 15:21189578-21189600 CTGCTGTGGCATGGATCAGTAGG + Intergenic
1123807842 15:23893609-23893631 GCATGGTGGCATGCACCTGTAGG - Intergenic
1124428039 15:29579847-29579869 GTGTGGTGGCGGACATCTGTAGG - Intergenic
1125514638 15:40311184-40311206 CTGTGGTGGCATGAAGCTGGTGG - Intergenic
1125618275 15:41035681-41035703 GTGTGGTGGCGGGCACCTGTAGG + Intronic
1125955748 15:43790001-43790023 GCGTGGTGGCACGCACCTGTAGG + Intronic
1126127653 15:45310393-45310415 GTGTGGTGGCATGCATCTGTGGG + Intergenic
1126418598 15:48446471-48446493 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1126664183 15:51060995-51061017 GCATGATGGCATGCATCTGTAGG + Intronic
1128371964 15:67046740-67046762 CCGTGGTGGGGTGCACCTGTAGG - Intergenic
1129208116 15:74049314-74049336 GTGTGGTGGTGTGCACCTGTAGG + Intergenic
1129338442 15:74868679-74868701 GTGTGGTGGCATGCACCTGTGGG - Intronic
1129644031 15:77413960-77413982 GTGTGGTGGCATGTGCCTGTGGG - Intronic
1129804184 15:78440496-78440518 ATGTGTTGGCATACACCTGTAGG - Intronic
1130942475 15:88523019-88523041 GTGTGGTGGCATGCGCCTGTCGG - Intronic
1130963811 15:88682347-88682369 CTTTGGTGACAGGCATGTGTGGG + Intergenic
1132472506 16:113556-113578 GGGTGGAGGCATGCAGCTGTGGG + Intronic
1132525848 16:414274-414296 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1133971202 16:10569455-10569477 GTATGGTGGCATGCACCTGTAGG - Intronic
1134205348 16:12233002-12233024 CTGTGGTGACTTGCATGTGAGGG - Intronic
1134304852 16:13022738-13022760 GTGTGGTGGTGTGCACCTGTAGG - Intronic
1134655741 16:15947257-15947279 GTGTGGTGGCAGGCACCTGCAGG - Intergenic
1134841374 16:17404608-17404630 CTGTTGTTGCATGCATGAGTGGG - Intronic
1135332867 16:21575589-21575611 GTGTGGTGGCATGCATCTGTAGG + Intergenic
1135566870 16:23517736-23517758 GTGTGGTGGCATGCACCTCAGGG - Intronic
1135625425 16:23990684-23990706 GTGTGGTGGCATGCACTTGTAGG - Intronic
1138103058 16:54270065-54270087 CTGCGGGGGCATGCATCTCGGGG - Intronic
1138725597 16:59135315-59135337 GCATGGTGGCATGCACCTGTAGG + Intergenic
1138754899 16:59471896-59471918 CTGACCTGGCATCCATCTGTTGG - Intergenic
1138915256 16:61455706-61455728 CTGTTGTTGCATGCAGGTGTTGG - Intergenic
1139525452 16:67513019-67513041 GAGTGGTGACATGCACCTGTTGG + Intergenic
1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG + Intronic
1141687873 16:85580590-85580612 CTGTGGTGGCTGACATCTGTTGG + Intergenic
1141799188 16:86295619-86295641 CATTGGTGGCCAGCATCTGTGGG - Intergenic
1142026568 16:87817452-87817474 CTGTTGTGTCCTGCATCCGTTGG - Intergenic
1142388396 16:89781860-89781882 GCGTGGTGGCAGGCATCTGTAGG + Intronic
1142543556 17:681273-681295 GTGTGGTGGCATGCACCTGTAGG - Intronic
1142739295 17:1921381-1921403 CCGTGCTGGCCTGCACCTGTGGG + Intergenic
1142774813 17:2128683-2128705 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1143505766 17:7364235-7364257 TCGTGGTGGCAGGCACCTGTAGG - Intergenic
1144033134 17:11340330-11340352 CTGTGGTTGCATTTAGCTGTGGG + Intronic
1145023248 17:19448415-19448437 CCATGGTGGCATGCACCTATGGG - Intergenic
1146167017 17:30597969-30597991 GAGTGGTGGCATGCACCTATAGG - Intergenic
1146230815 17:31107401-31107423 GCATGGTGGCATGCACCTGTGGG - Intronic
1146702454 17:34973199-34973221 TTTTGGTGGCATGCACCTGTGGG + Intronic
1147565657 17:41535069-41535091 AGGTGGTGGCGTGGATCTGTGGG + Intergenic
1147588124 17:41664695-41664717 TCATGGTGGCATGCATCTGTAGG + Intergenic
1147884246 17:43674111-43674133 CTGTGCCTGCATGCAGCTGTGGG - Intergenic
1148161139 17:45450827-45450849 CTGTGGTGGAAAGGATCTGCTGG + Intronic
1149184528 17:53981594-53981616 ATGTGGTGGTGTGCACCTGTAGG - Intergenic
1149247914 17:54733230-54733252 GGGTGGTGGCAGGCACCTGTAGG + Intergenic
1149815013 17:59714816-59714838 GTGTGGTGGCATGCACCTCATGG - Intronic
1150374731 17:64671586-64671608 GAGTGGTGGCATGCACCTATAGG + Intergenic
1150392373 17:64797473-64797495 CTGTGGTGGAAAGGATCTGCTGG + Intergenic
1150578236 17:66449148-66449170 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1150870022 17:68897033-68897055 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1151131674 17:71903593-71903615 GTGTGGTGGTGTGCACCTGTTGG + Intergenic
1151377050 17:73696940-73696962 CTGTGTGTGCATGCATGTGTTGG - Intergenic
1151377053 17:73697024-73697046 CTGTGTGTGCATGCATGTGTTGG - Intergenic
1151609083 17:75159617-75159639 GTGTGGTGGCATGTGCCTGTAGG - Intronic
1152123647 17:78433672-78433694 CTGTGGTGGCAGGATTCTGGGGG + Intronic
1152483968 17:80577414-80577436 GTGTGGTGGCATGCACCTGTAGG - Intronic
1153034256 18:744526-744548 GCGTGGTGGCATGCACCTGTAGG - Intronic
1154981010 18:21502322-21502344 CTGTGCTGGCAGGGAACTGTGGG + Intronic
1155125074 18:22866249-22866271 GTGTGGTGGCACGCACCTGTAGG + Intronic
1155631367 18:27897269-27897291 GTGTGGTGGCACACACCTGTAGG + Intergenic
1156213190 18:34969493-34969515 GTATGGTGGCATGCACCTGTAGG - Intergenic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1156284191 18:35674842-35674864 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1157350832 18:46883865-46883887 GTGTGGTGGTATACACCTGTGGG + Intronic
1158260470 18:55600690-55600712 CTCTGGTGGCATTCCTCTTTGGG + Intronic
1158794638 18:60829555-60829577 GTGTGGTGGCAGGCGCCTGTAGG - Intergenic
1159136102 18:64338373-64338395 CAGTGGTGGCAAGCACCTCTGGG - Intergenic
1159446717 18:68549905-68549927 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1159506983 18:69351432-69351454 GTGTGCTGGCATGTACCTGTGGG + Intergenic
1160308768 18:77769119-77769141 CTGTGGTGGCATGGCTGTGATGG + Intergenic
1160308838 18:77769455-77769477 CTGTGGTGGCATGGCTGTGATGG + Intergenic
1160308846 18:77769497-77769519 CTGTGGTGGCATGGCTATGATGG + Intergenic
1160308913 18:77769874-77769896 CTGTGGTGGCATGGCTGTGATGG + Intergenic
1160435658 18:78850525-78850547 CTGTTGTGGGAGGGATCTGTTGG - Intergenic
1161007557 19:1944075-1944097 CGGTGGTGGCGGGCAGCTGTGGG + Intronic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1162065028 19:8120306-8120328 GTGTGGTGGCGTGCACCTGTAGG - Intronic
1162598185 19:11645549-11645571 GTGTGGTGGCGGGCACCTGTAGG - Intergenic
1162729622 19:12710574-12710596 CTGTGCTGGCATGAGACTGTAGG - Intronic
1162849803 19:13422180-13422202 GTGTAATGGCATGCACCTGTGGG + Intronic
1163285340 19:16343471-16343493 ATGCAGTGGCATGCACCTGTAGG + Intergenic
1163808110 19:19412491-19412513 GTGTGGTGGCATGCATCTGTAGG + Intronic
1164468445 19:28508023-28508045 CTGAGTTGGCATGAATTTGTTGG - Intergenic
1165176051 19:33930650-33930672 GTGTGGTGGCGTGTGTCTGTAGG - Intergenic
1165219217 19:34301287-34301309 GTGTGGTGGTGTGCACCTGTTGG + Intronic
1165833366 19:38740470-38740492 GTGTGGTGGTGTGCACCTGTGGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167140298 19:47645957-47645979 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1167737485 19:51304891-51304913 GCATGCTGGCATGCATCTGTAGG + Intergenic
1168379414 19:55907431-55907453 GTGTGGTGGCACACACCTGTGGG + Intronic
925129840 2:1487018-1487040 CTCTGGTGGCATGCAGTGGTGGG + Intronic
925948662 2:8890656-8890678 GTGTGGTAGCATGTACCTGTAGG - Intronic
926662515 2:15482923-15482945 ATGTGGTAGCATGAATATGTCGG - Intronic
926881567 2:17550691-17550713 CTGTGTTTGCATGCATATGTGGG - Intronic
927274278 2:21248723-21248745 GCATGGTGGCATGCACCTGTAGG - Intergenic
927933940 2:27064432-27064454 GTGTGGTGGTGTGCACCTGTAGG - Intronic
927996150 2:27488119-27488141 GTGTGGTGGCAAGCACCTGTAGG - Intronic
928988426 2:37204414-37204436 GCGTGGTGGCATGCACTTGTAGG - Exonic
929575768 2:43050672-43050694 CTGTGCCAGCAAGCATCTGTCGG - Intergenic
929616950 2:43318176-43318198 ATGTGGTAGCACACATCTGTAGG - Intronic
929736387 2:44554735-44554757 GTGTGGTGGCATATGTCTGTAGG + Intronic
929747422 2:44673286-44673308 GTATGGTGGCATGTACCTGTGGG + Intronic
930201293 2:48554100-48554122 TTGTGCTGGGCTGCATCTGTTGG + Intronic
930633186 2:53776678-53776700 GTGTAGTGGCATGCACCTGTAGG + Intronic
930657327 2:54019203-54019225 GTGTGGTGGCATGCACCTACAGG - Intronic
930850751 2:55957960-55957982 ATGTGGTGGCACACACCTGTAGG - Intergenic
931014850 2:57964745-57964767 TTGTGGTGGCACGCACCTGTAGG + Intronic
931350343 2:61482187-61482209 CAGAAGTGGTATGCATCTGTAGG - Intronic
931745021 2:65284243-65284265 GTGTGGTGGCGGGCACCTGTAGG + Intergenic
932884172 2:75533002-75533024 GTATGGTGGCATGCACCTGTGGG + Intronic
933251435 2:80033432-80033454 GCTTGGTGGCATGCACCTGTAGG + Intronic
933913067 2:86960726-86960748 GTGTGGTGGCGGGCACCTGTAGG - Intronic
934009928 2:87809164-87809186 GTGTGGTGGCGGGCACCTGTAGG + Intronic
935773506 2:106449876-106449898 GTGTGGTGGCAGGCACCTGTAGG + Intronic
935906558 2:107846063-107846085 GTGTGGTGGCAGGAACCTGTAGG - Intronic
935973927 2:108558807-108558829 GTGTGGTGGCATACAACTGTAGG - Intronic
935992957 2:108738212-108738234 GTGTGGTGGCGGGCACCTGTAGG - Intronic
936128347 2:109811182-109811204 GTGTGGTGGCGGGCACCTGTAGG - Intronic
936142087 2:109949105-109949127 ATATGGTAGAATGCATCTGTTGG - Intergenic
936178777 2:110247065-110247087 ATATGGTAGAATGCATCTGTTGG - Intergenic
936202601 2:110422368-110422390 ATATGGTAGAATGCATCTGTTGG + Intronic
936216350 2:110560303-110560325 GTGTGGTGGCGGGCACCTGTAGG + Intronic
936425490 2:112414879-112414901 GTGTGGTGGCGGGCACCTGTAGG + Intronic
936501021 2:113066415-113066437 GCATGGTGGCATGCACCTGTAGG - Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
936716127 2:115189766-115189788 GTGTCATAGCATGCATCTGTGGG - Intronic
938712275 2:133985468-133985490 CTGTGGTTTCAGGCATCTGCTGG - Intergenic
938989374 2:136612218-136612240 GCATGGTAGCATGCATCTGTAGG - Intergenic
940130686 2:150378072-150378094 GTGTGGTGGTGTGCACCTGTAGG + Intergenic
940944913 2:159605164-159605186 GTGTGGTGGCATGCACCCGTAGG - Intronic
942308716 2:174634148-174634170 CTGTGTTTGCAGACATCTGTGGG - Intronic
943239717 2:185366898-185366920 CTGTGGTTGCAGGCATCCATTGG + Intergenic
943670688 2:190657322-190657344 CTGAGGTGGCATGAATGTGAAGG + Intronic
944052783 2:195490276-195490298 CAGTGGTGGCACTCCTCTGTAGG - Intergenic
944526055 2:200620742-200620764 CTGTGATGACATGCCTCTGGTGG + Exonic
944536744 2:200717710-200717732 GTGTAGTGGCTTGCGTCTGTGGG + Intergenic
945089128 2:206162265-206162287 CAGTTGTGGCATTCCTCTGTGGG + Intronic
946709934 2:222495273-222495295 GTGTGGTGGCATGTGCCTGTGGG + Intronic
946999041 2:225432114-225432136 GCGTGGTGGCAGGCATGTGTAGG - Intronic
947153580 2:227138177-227138199 GTGTAGTGGCATGTACCTGTAGG + Intronic
947400141 2:229723741-229723763 GTATGGGGGCATGCACCTGTGGG - Intergenic
948547327 2:238742202-238742224 CTGTGGAAGTATGCAGCTGTGGG + Intergenic
1169237863 20:3946571-3946593 GTGTGGTGGCATGCATAGCTGGG - Intronic
1169654247 20:7904849-7904871 CTGTGGCTGCATTCAACTGTGGG - Intronic
1170614771 20:17939645-17939667 CAGTGGTGGCATACACCTGGAGG - Intergenic
1171431936 20:25088409-25088431 CTGGGGTGGCAGTCATCTGAGGG + Intergenic
1172135919 20:32686628-32686650 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1172255250 20:33512036-33512058 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1172280657 20:33705460-33705482 GTGTGGTGGCGGGCACCTGTAGG + Exonic
1172470786 20:35193312-35193334 GCGTGGTGGCATGCGCCTGTAGG - Intergenic
1172743520 20:37188291-37188313 GTGTGGTGGCGTGCACCTATAGG - Intronic
1172896373 20:38303044-38303066 CTGGTGTGGGATGCATCTGGAGG + Intronic
1173731949 20:45335317-45335339 ATGTGGTGGCATGCACCTGTAGG - Intronic
1174347602 20:49942118-49942140 GTGTGGTGGTATGTACCTGTAGG + Intronic
1174356425 20:50001303-50001325 GTGTAGTGGCATGCACCTGTAGG - Intergenic
1174378653 20:50142575-50142597 CCGTGGTGGCAGGCGCCTGTAGG - Intronic
1174609554 20:51787958-51787980 GCGTGGTGGCATGCGCCTGTAGG - Intronic
1174729814 20:52904908-52904930 ATGTGGTGGGATCCATCTCTTGG - Intergenic
1175006714 20:55691105-55691127 GTGTGGTGGCGGGCACCTGTAGG + Intergenic
1176735430 21:10541886-10541908 CTGTGGTGGCAGGGTTCTGGAGG - Intronic
1178316397 21:31570026-31570048 ATGTGGTGGTGTGCACCTGTGGG + Intergenic
1178578014 21:33812635-33812657 GCATGGTGGCATGCACCTGTAGG - Intronic
1178763019 21:35422204-35422226 AAGTGGTGGAATGCATCTGTGGG - Intronic
1178824262 21:36002322-36002344 GCATGGTGGCATGCACCTGTGGG + Intronic
1179011660 21:37561203-37561225 CTGTGGTGGTGCGCACCTGTAGG - Intergenic
1179173495 21:38991009-38991031 CTGTGCTGGGATGCACCTGTTGG + Intergenic
1179444367 21:41420852-41420874 CTGTGGTGTCAGGCACCTGAAGG + Intronic
1180486691 22:15807284-15807306 GTGTGGTGGTACGCACCTGTGGG - Intergenic
1181157188 22:20930516-20930538 GTGTGGTGGCGTGCGCCTGTAGG - Intronic
1181648058 22:24244407-24244429 GTGTGATTGCATGCATGTGTGGG - Intronic
1182209102 22:28659405-28659427 ACGTGGTGGCATGAACCTGTAGG - Intronic
1182786551 22:32912580-32912602 GGGTGGTGGCATGCACCTGTAGG + Intronic
1184557039 22:45239226-45239248 CTGAGCTGGGATGCATCTGAAGG - Intronic
949344658 3:3065631-3065653 CTGTGGTGGCACGTGCCTGTAGG + Intergenic
950240834 3:11368643-11368665 GTGTGGTGGCACGCACCTGTGGG + Intronic
950396351 3:12737015-12737037 GTGTGGTGGCATGCACTTGTAGG - Intronic
950622338 3:14215851-14215873 GTGTGGTGGCACACATCTGTAGG - Intergenic
950935509 3:16835081-16835103 GTGACGTGGTATGCATCTGTAGG - Intronic
951017783 3:17748522-17748544 GTGTGGTGGCAGGCACCTGTAGG - Intronic
951104015 3:18722040-18722062 ATGTGGTGGCAAGCGCCTGTAGG - Intergenic
953321245 3:41973854-41973876 GTGTGGTGGCACACATGTGTAGG - Intergenic
953739846 3:45528196-45528218 ATGTGGTGGCATGTGTCTGTAGG + Intronic
953860760 3:46542355-46542377 GTGTGGTGGCATGCACCTGTTGG + Intronic
954506170 3:51076321-51076343 ATGTGGTGGCATGCACCTGTAGG + Intronic
954725508 3:52605471-52605493 CTCTAGTGGCATGTATCAGTAGG - Intronic
956236595 3:67079183-67079205 GCGTGGTGGCATACACCTGTGGG - Intergenic
956420049 3:69078610-69078632 GTATGGTGGCATGTACCTGTAGG - Intronic
958536244 3:95408220-95408242 CTGTGGTCACCTGCAGCTGTTGG - Intergenic
959061806 3:101623056-101623078 GCATGGTGGCATGCACCTGTAGG - Intergenic
959208780 3:103348102-103348124 CTGTAGTTGCATGTATATGTAGG + Intergenic
959766259 3:110033185-110033207 GTGTGGTGGCAGGCACCTGTGGG - Intergenic
961364085 3:126388507-126388529 GTGTGGTGGCATGCCTGTGGTGG + Intergenic
961364088 3:126388521-126388543 CTGTGGTGGCATGCCTGTGGTGG + Intergenic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
963116168 3:141731029-141731051 CTGTGGTGGCATGTGCCCGTAGG + Intergenic
963293639 3:143520231-143520253 CTGTGATGGTATTCATTTGTGGG + Intronic
964285654 3:155115007-155115029 CAGTGGTGGCATCCATGTTTTGG - Exonic
965270988 3:166617291-166617313 GTGGGGTGGCATGCATCTGTAGG + Intergenic
965942410 3:174201097-174201119 GTGTGGTGGCACACACCTGTAGG + Intronic
966890345 3:184402994-184403016 CTGTGGTTGCTTGCATCCCTGGG + Intronic
967004145 3:185367732-185367754 CTATAGTGGCATGTGTCTGTGGG - Intronic
967235183 3:187377232-187377254 CTGTGGTGGTATGCAGGTGGGGG - Intergenic
967300587 3:188008646-188008668 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
967517794 3:190390922-190390944 TTGTGGGGACATGCACCTGTAGG - Intronic
969081989 4:4626221-4626243 GTGTGGTGGCTCGCACCTGTAGG - Intergenic
970910500 4:21269542-21269564 GCATGGTGGCATGCACCTGTAGG - Intronic
971484507 4:27145557-27145579 CTGTTGTGACATGGATATGTTGG - Intergenic
971862687 4:32128350-32128372 CTGTGGTCTCATGTATCTTTGGG + Intergenic
972489565 4:39574377-39574399 GCATGGTGGCATGCACCTGTAGG - Intronic
972495423 4:39629760-39629782 GTGTGATGGCATGCACCTGTGGG - Intronic
974180077 4:58373074-58373096 GTGTGCAGGCATGCATGTGTGGG + Intergenic
974806098 4:66882766-66882788 CTTTGGTGGCTTGCAGGTGTTGG + Intergenic
977891183 4:102313726-102313748 ACATGGTGGCATGCACCTGTAGG - Intronic
981129906 4:141147091-141147113 GTGTGGTGACATACACCTGTAGG - Intronic
981531688 4:145760508-145760530 CTGGGGAGGCATGCCTCTGAAGG + Intronic
981724616 4:147834328-147834350 TGGTGGTGGCACGCATCTGTAGG + Intronic
981764228 4:148229616-148229638 CTGTGGTAACATGTATCTATGGG - Intronic
982855222 4:160373776-160373798 CTGTGGTGGCAGTACTCTGTAGG + Intergenic
983331768 4:166339059-166339081 GTGTGGTGGCGGGCACCTGTGGG - Intergenic
984187541 4:176564421-176564443 GCATGGTGGCATGCACCTGTAGG - Intergenic
985583494 5:712768-712790 GTGTGGTGGCGGGCAACTGTAGG + Intronic
985587980 5:750787-750809 CTGTGGGGCCATGTAGCTGTGGG - Intronic
986758753 5:10860877-10860899 CTCTGGTTGCCTGCAACTGTGGG + Intergenic
987787377 5:22519034-22519056 CTCTGGTGGCATGGATGAGTTGG - Intronic
988603536 5:32661352-32661374 CTGTGGTGGCACCCATGTGGGGG + Intergenic
988643979 5:33073465-33073487 GTGTGGTGGCATGTACCTTTAGG - Intergenic
989779474 5:45247056-45247078 CTGTGATTGCATGCATGTGCTGG + Intergenic
990207110 5:53441581-53441603 TTGTGGTGGCACGCGCCTGTAGG - Intergenic
990436323 5:55795632-55795654 GTGTGGTGACACGCACCTGTAGG + Intronic
990514484 5:56518951-56518973 ACGTGGGGGCATGGATCTGTGGG - Intronic
990580990 5:57167510-57167532 GTGTGGTGGCATGTGCCTGTAGG + Intergenic
990921189 5:60969753-60969775 CTTTGGTTGCCTGCACCTGTAGG + Intronic
992295315 5:75321665-75321687 GTGTGGTGGCATGAGCCTGTAGG + Intergenic
993883823 5:93394433-93394455 CTGTGGTGTGAACCATCTGTGGG + Intergenic
993991500 5:94663503-94663525 GTGTGGTGGCACGCATCCATAGG + Intronic
994098507 5:95869317-95869339 GCATGGTGGCATGCACCTGTAGG + Intergenic
995243519 5:109912130-109912152 CAGAGGTGTCATGCTTCTGTTGG + Intergenic
995525633 5:113048686-113048708 CTGTGGTTTCAGGCATCTATGGG + Intronic
995560300 5:113374041-113374063 GCGTGGTGGCATGCGCCTGTGGG - Intronic
995896582 5:117019236-117019258 GTGTGGTGGCGGGCACCTGTAGG + Intergenic
996547063 5:124691129-124691151 GTATGGTGGCACACATCTGTAGG + Intronic
998533224 5:142904349-142904371 GTGTGGTGGTGTGCACCTGTGGG + Intronic
998944139 5:147319279-147319301 GGGTGGTGGCATGCACCCGTAGG - Intronic
999185336 5:149703211-149703233 CTGTGGTGTGATGCATAGGTGGG - Intergenic
999287750 5:150404429-150404451 CTGTGGTGACAGGCCTCTGTGGG + Intronic
999473295 5:151875309-151875331 GCATGGTGGCATGCACCTGTAGG - Intronic
1000961229 5:167603540-167603562 GTGTAGTGGCATACACCTGTGGG + Intronic
1001142841 5:169159635-169159657 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1001743354 5:174071345-174071367 GTGTGGTGGCACGCACCTATAGG + Intronic
1002095893 5:176830712-176830734 GTGTGCTGGCATGTATGTGTGGG + Intronic
1003595725 6:7472561-7472583 CTGTGGTGGAACGCAACTGTGGG - Intergenic
1005287802 6:24347426-24347448 CTGTGGTTGGTTGAATCTGTGGG - Intronic
1005298522 6:24449323-24449345 CTATGGTAGGAAGCATCTGTGGG + Intronic
1006094607 6:31648152-31648174 GTGTGGTGGCACGCGCCTGTAGG - Intronic
1006346798 6:33488844-33488866 GCGTGGTGGCACGCACCTGTAGG + Intergenic
1007714063 6:43844198-43844220 ATGTTGTGGCATGTATCAGTAGG + Intergenic
1007833238 6:44654805-44654827 CCCTGGTGGCATGCACCTGTGGG + Intergenic
1008738935 6:54581226-54581248 GTGTGGTGGCTTGCACCTGTAGG - Intergenic
1010107499 6:72186990-72187012 GTGTGGTGGCATGCGCCTGTAGG + Intronic
1011753619 6:90477410-90477432 GTGTGGTGGCACACACCTGTAGG + Intergenic
1012335648 6:98053293-98053315 GTGTGGTGGTATGCACCTGTAGG - Intergenic
1013256841 6:108395978-108396000 GTGTGGTGGCACACACCTGTGGG - Intronic
1014741978 6:125156325-125156347 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1014926730 6:127280303-127280325 TTTTTGTGGCAGGCATCTGTGGG + Exonic
1015161535 6:130157465-130157487 ATGTGGTGGCATGGCCCTGTAGG - Intronic
1015726617 6:136306018-136306040 CTGTGGTTCCATGCAGATGTTGG - Intergenic
1015764829 6:136705439-136705461 TTGTGGTGGCATGTACCTGTAGG - Intronic
1016971046 6:149764599-149764621 GTGTGGTGGCATGCACATGTAGG + Intronic
1017404176 6:154099144-154099166 GCGCGGTGGCATGCACCTGTAGG + Intronic
1019578096 7:1747155-1747177 CTGTGGTGGCGTGCGTGTGTTGG - Exonic
1020432070 7:8124925-8124947 GTGTGGTGGTGTGCACCTGTAGG - Intronic
1022007000 7:26275173-26275195 GTGTGGTGGCATGTGACTGTAGG - Intergenic
1023812583 7:43923423-43923445 ATGTGGTGGTGTGCATCTGAGGG - Intronic
1024189929 7:46995654-46995676 GTGTGGTCGCACACATCTGTGGG + Intergenic
1024818898 7:53303987-53304009 CTGTGGGGACTTGCATCTGCAGG - Intergenic
1026989941 7:74579180-74579202 ACGTGGTGGTATGCACCTGTAGG + Intronic
1027571364 7:79871417-79871439 GTGTGGTGGCACGCGCCTGTAGG - Intergenic
1029108137 7:98194992-98195014 CCATGGTGGCATGAACCTGTGGG - Intronic
1031138926 7:117919561-117919583 CTGTGATGTCAACCATCTGTGGG - Intergenic
1032829162 7:135605161-135605183 GCGTGGTGGCATGCACCTGTAGG - Intronic
1032846364 7:135755020-135755042 CTGCTGTGGCCTGCAGCTGTGGG + Intergenic
1034003807 7:147446036-147446058 CTGTGATGGTATGCAGGTGTAGG - Intronic
1034210646 7:149359212-149359234 CTGTGGTGGCAGGAGGCTGTGGG - Intergenic
1035643669 8:1202182-1202204 GTGTGGTGTGATGTATCTGTTGG + Intergenic
1036481070 8:9140091-9140113 CTCTGCTGGAATACATCTGTGGG + Exonic
1036981978 8:13479925-13479947 GTGTGGTGGCGTGTGTCTGTAGG + Intronic
1037506322 8:19533253-19533275 GTGTGGTGGTATGTACCTGTAGG - Intronic
1038596154 8:28888595-28888617 CTTAGGTTGCATGCTTCTGTAGG + Intronic
1038675915 8:29622913-29622935 GTGTGGTGGCAGGCGCCTGTAGG - Intergenic
1038767085 8:30438910-30438932 GTGTGGTGGCATGCGCCTGTAGG - Intronic
1039041757 8:33415121-33415143 CTGTGGTGGCATGTGCCTGTAGG + Intronic
1041996973 8:64074332-64074354 CTGTGTTAGCATGGATCTCTAGG + Intergenic
1042221826 8:66482095-66482117 ATGTGGTGGCAGGCACCTGTAGG - Intronic
1042711110 8:71718634-71718656 CTGTGGTGGCATGTGCCTGTAGG + Intergenic
1043840136 8:85093211-85093233 GCATGGTGGCATGCACCTGTAGG + Intergenic
1044832682 8:96265632-96265654 GCGTGGTGGCATGCACCTGGAGG + Intronic
1044871284 8:96622329-96622351 CCGTGGTGGCATGCGCCTGTAGG - Intergenic
1044887814 8:96798266-96798288 GTGTGGTGGCATGCACCTGTGGG - Intronic
1045872878 8:106946239-106946261 GCGTCGTGGCATGCGTCTGTAGG - Intergenic
1047051155 8:121115014-121115036 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1047602677 8:126442094-126442116 TCATGGTGGCGTGCATCTGTAGG + Intergenic
1047798741 8:128286522-128286544 GTGTGGTGGCATACACCTGGAGG + Intergenic
1048260807 8:132943622-132943644 CTGTGGTGCCATGCACATGTTGG - Intronic
1048924697 8:139261078-139261100 CTGTGGTGGGAGGAATTTGTTGG - Intergenic
1049035492 8:140072391-140072413 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1049107063 8:140620728-140620750 GCATGGTGGCATGCATCTGTGGG + Intronic
1049280981 8:141744406-141744428 CTGTGGTGGTGGGCACCTGTAGG - Intergenic
1049604608 8:143523497-143523519 CTGAGGTGGCTTCCGTCTGTAGG - Intronic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1050207302 9:3210613-3210635 GTGTGGTGGCATACGCCTGTTGG - Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1053305559 9:36982124-36982146 GTGTGGTGGCACACACCTGTAGG + Intronic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1055192232 9:73539297-73539319 CTCTGCAGGCAAGCATCTGTGGG - Intergenic
1055835939 9:80441947-80441969 GCATGGTAGCATGCATCTGTAGG + Intergenic
1055985612 9:82055082-82055104 GCGTGGTGGCAGGCACCTGTAGG + Intergenic
1056499645 9:87196226-87196248 CCGTGGTCGCTTGCATCTGTGGG - Intergenic
1056988702 9:91389579-91389601 GTGTGGTGGCATGCACCTATGGG - Intergenic
1057025093 9:91728850-91728872 GTGGAGTGGCATGCAGCTGTGGG - Intronic
1058797767 9:108515237-108515259 ATGTGGTGGTATGTTTCTGTTGG + Intergenic
1059122314 9:111652377-111652399 GCGTGGTGGCATGCTCCTGTAGG + Intronic
1060346924 9:122825298-122825320 GTGTGGGGGCATGCGGCTGTAGG - Intronic
1060642287 9:125249164-125249186 GTGTGGTGGCAGACACCTGTAGG - Intergenic
1061075154 9:128336766-128336788 GCGTGGTGGCATGCATCCATAGG - Intergenic
1061079349 9:128360886-128360908 CAGTGGTAGCATCCATCTGGTGG + Exonic
1061344107 9:130008208-130008230 GTGTGGTGTCATGCGCCTGTGGG + Intronic
1061856749 9:133445692-133445714 CAGAGGTGGCATCCAGCTGTGGG - Exonic
1062086934 9:134653856-134653878 CTGTAGGGCCAGGCATCTGTAGG + Intronic
1062510559 9:136903086-136903108 ATGTGGTGGCAGGCGCCTGTAGG - Intronic
1062562419 9:137147590-137147612 CAGGGGTGGCATGCGCCTGTGGG - Intronic
1062664225 9:137658749-137658771 GTATGGTGGTATGCACCTGTAGG - Intronic
1185728449 X:2441933-2441955 GTGTGGTGGCGTGCGCCTGTAGG + Intronic
1185793888 X:2948627-2948649 CTGTGGTGGCATGGACTTGTAGG - Intronic
1186379964 X:9047510-9047532 GTATGGTGACATGCATATGTGGG + Intronic
1187314141 X:18176538-18176560 GTATGGTGGCATGCACCTGTGGG + Intronic
1187439721 X:19307272-19307294 CTGTGGGGGCATCCATCTTGTGG + Intergenic
1188140093 X:26539485-26539507 CTGTGCTTCCAAGCATCTGTTGG - Intergenic
1188298243 X:28476610-28476632 GCATGGTGGCATGCACCTGTAGG - Intergenic
1188355442 X:29184637-29184659 GTGTGGTGGCATGAGCCTGTAGG - Intronic
1189684160 X:43546380-43546402 GCGTGGTGGCATGTGTCTGTAGG - Intergenic
1189989187 X:46578413-46578435 ATGTGGTGGTACGCACCTGTGGG - Intronic
1190954204 X:55175567-55175589 TGGTGGTGGCATTCACCTGTAGG + Intronic
1193557452 X:82973731-82973753 CTGTGGTGGGGTGCATGTGGGGG - Intergenic
1195028393 X:100901444-100901466 CTGTTGTTGCATGCATGTTTAGG - Intergenic
1196397790 X:115284429-115284451 ATGTGGTGGCACACACCTGTGGG + Intergenic
1196756181 X:119159471-119159493 ATGTGGTGGCGTGCACCTGTAGG - Intergenic
1197852228 X:130874838-130874860 CGGGGGGGGCATGCATGTGTTGG - Intronic
1197940720 X:131786009-131786031 GCGTGGTGGCATGCACCTGTGGG + Intergenic
1198074730 X:133183495-133183517 GTGTGGTGGTATGTACCTGTAGG + Intergenic
1199301382 X:146218223-146218245 GCGTGATGGCATGCACCTGTAGG - Intergenic
1199835023 X:151581449-151581471 GCATGGTGGCATGCACCTGTAGG + Intronic
1200110709 X:153739510-153739532 GCATGGTGGCGTGCATCTGTAGG + Intronic
1201542738 Y:15125840-15125862 CTGTGGTCTCAGGCATCTGCTGG + Intergenic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic