ID: 1097174330

View in Genome Browser
Species Human (GRCh38)
Location 12:57134085-57134107
Sequence GGTCCCCAGGGCCACCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 2, 2: 0, 3: 42, 4: 306}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097174330_1097174348 13 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174348 12:57134121-57134143 GTGCCTGGGTTTGGGGGGGTGGG 0: 1
1: 0
2: 1
3: 64
4: 703
1097174330_1097174347 12 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174347 12:57134120-57134142 GGTGCCTGGGTTTGGGGGGGTGG 0: 1
1: 1
2: 7
3: 145
4: 1328
1097174330_1097174337 -9 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174337 12:57134099-57134121 CTGGGGACCGTGGCTGGGCTGGG 0: 1
1: 0
2: 2
3: 49
4: 609
1097174330_1097174341 4 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174341 12:57134112-57134134 CTGGGCTGGGTGCCTGGGTTTGG 0: 1
1: 0
2: 2
3: 52
4: 535
1097174330_1097174342 5 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174342 12:57134113-57134135 TGGGCTGGGTGCCTGGGTTTGGG 0: 1
1: 0
2: 1
3: 30
4: 414
1097174330_1097174344 7 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174344 12:57134115-57134137 GGCTGGGTGCCTGGGTTTGGGGG 0: 1
1: 1
2: 1
3: 100
4: 802
1097174330_1097174345 8 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174345 12:57134116-57134138 GCTGGGTGCCTGGGTTTGGGGGG 0: 1
1: 0
2: 1
3: 52
4: 613
1097174330_1097174340 -1 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174340 12:57134107-57134129 CGTGGCTGGGCTGGGTGCCTGGG 0: 1
1: 0
2: 1
3: 49
4: 583
1097174330_1097174353 25 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174353 12:57134133-57134155 GGGGGGGTGGGGCAGGGTGTTGG 0: 1
1: 1
2: 20
3: 384
4: 2930
1097174330_1097174346 9 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174346 12:57134117-57134139 CTGGGTGCCTGGGTTTGGGGGGG 0: 1
1: 0
2: 4
3: 83
4: 807
1097174330_1097174349 14 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174349 12:57134122-57134144 TGCCTGGGTTTGGGGGGGTGGGG 0: 1
1: 0
2: 7
3: 132
4: 1133
1097174330_1097174343 6 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174343 12:57134114-57134136 GGGCTGGGTGCCTGGGTTTGGGG 0: 1
1: 0
2: 11
3: 59
4: 666
1097174330_1097174352 19 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174352 12:57134127-57134149 GGGTTTGGGGGGGTGGGGCAGGG 0: 1
1: 1
2: 28
3: 298
4: 2423
1097174330_1097174336 -10 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174336 12:57134098-57134120 CCTGGGGACCGTGGCTGGGCTGG 0: 1
1: 0
2: 3
3: 53
4: 516
1097174330_1097174339 -2 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174339 12:57134106-57134128 CCGTGGCTGGGCTGGGTGCCTGG 0: 1
1: 0
2: 3
3: 56
4: 483
1097174330_1097174351 18 Left 1097174330 12:57134085-57134107 CCAGCTTGGTGGCCCTGGGGACC 0: 1
1: 2
2: 0
3: 42
4: 306
Right 1097174351 12:57134126-57134148 TGGGTTTGGGGGGGTGGGGCAGG 0: 1
1: 1
2: 30
3: 437
4: 4133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097174330 Original CRISPR GGTCCCCAGGGCCACCAAGC TGG (reversed) Intronic
900123974 1:1061455-1061477 GGTCCCCAGGGGGACCAGCCAGG + Intergenic
900180805 1:1310175-1310197 TGTCCCGAGGGCCACCCACCAGG + Intronic
900407216 1:2498034-2498056 GGGCCACAGGGGGACCAAGCTGG - Intronic
900412985 1:2521476-2521498 CGACCTCAGGGCCACCCAGCAGG + Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900496645 1:2978832-2978854 AGGGCCCAGGGCCACCAAGCAGG + Intergenic
900652519 1:3736927-3736949 TGTCCCCACGTCCACCAAGGAGG + Intergenic
901680647 1:10910766-10910788 GGTGCCAAGGGACACCAAGCAGG + Intergenic
901720832 1:11196082-11196104 GGTGTTCAGGGCAACCAAGCGGG + Intronic
901760159 1:11465760-11465782 GGTCCCCAGGTCCCCCAGTCAGG - Intergenic
902001165 1:13195490-13195512 GGTTCCCAGGCCCAGCAATCGGG + Intergenic
902020398 1:13341194-13341216 GGTTCCCAGGCCCAGCAATCGGG + Intergenic
902577363 1:17386737-17386759 CATCCCCAGGGCCTCCAAGGAGG + Intronic
902648242 1:17819076-17819098 GGTCACTTGGGCCACCAACCTGG + Intronic
903648888 1:24911164-24911186 GGTCCCCACGTCCACCCGGCAGG - Intronic
904044572 1:27602168-27602190 CAGCCCCAGGGCCCCCAAGCTGG + Intronic
904461333 1:30682108-30682130 GACCCCCAAGGCCACCCAGCTGG - Intergenic
905910144 1:41647912-41647934 GGGTCCCAGGCCCACCAGGCAGG - Intronic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907516210 1:54994934-54994956 GGTCACCAAGCCCACCCAGCGGG - Intergenic
907785307 1:57605757-57605779 GGTACCCAAGGCCATCAATCAGG - Intronic
907938693 1:59066217-59066239 GCTCCCCAGGGCCCCAGAGCTGG + Intergenic
915307240 1:154987618-154987640 TGTCCCCACTGCCACCAAGCAGG - Intronic
918313907 1:183306816-183306838 GGTACCCAAGGTCACCCAGCTGG - Intronic
919746176 1:201010474-201010496 GGTTCCCATGGCAACCAAGCAGG + Intronic
919979373 1:202632826-202632848 CTTCTCCAAGGCCACCAAGCTGG - Intronic
920211693 1:204333131-204333153 GGCCCCCAGCTCCACCAGGCGGG + Intronic
922674182 1:227541023-227541045 AGTCCCCAAGGCCACAAACCAGG + Intergenic
922696130 1:227731935-227731957 GCTCACCAGGGCCTCCAGGCAGG - Exonic
922791556 1:228313960-228313982 GGCCCCCAGGGCCACAGAGTGGG + Intronic
923540711 1:234886199-234886221 GGTCCCCTGAGCCAGGAAGCTGG - Intergenic
923800751 1:237206028-237206050 GGCCACCGGGTCCACCAAGCGGG + Intronic
924551596 1:245083089-245083111 GGACCCCTGGGCCACACAGCAGG + Intronic
1063665107 10:8056113-8056135 AGGCCCCAGGGCCACCAGCCGGG - Intronic
1066296544 10:34058878-34058900 GGTTCCCAGGGCCAATTAGCTGG + Intergenic
1067556745 10:47278150-47278172 GGTCCCCAGGGTGACCCCGCCGG + Intergenic
1067661321 10:48238085-48238107 GATCCCCAGGACCAGCAGGCGGG - Exonic
1068975347 10:63003231-63003253 TGTGCCCAAGGTCACCAAGCAGG + Intergenic
1069598363 10:69687204-69687226 GGCCACCAGGACCACCAAGCTGG - Intronic
1069827971 10:71265844-71265866 TGTCCCCAGGTCCCCCATGCTGG + Intronic
1071508676 10:86247928-86247950 TGTCTCCAGATCCACCAAGCAGG + Intronic
1072613674 10:97035495-97035517 GGTGACCAGGGCCACCAGCCAGG - Intronic
1072664610 10:97384419-97384441 GGTCCTCAGGGCTACCATCCTGG - Intronic
1075172316 10:120127459-120127481 TGCCCCCAGTGCCACCCAGCTGG - Intergenic
1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG + Intergenic
1076769794 10:132656691-132656713 GGTCCTGAAGGGCACCAAGCAGG + Intronic
1076783212 10:132735833-132735855 AGCCTCCAGGGCCACCAAGCTGG - Intronic
1076998388 11:310505-310527 GGTCCCCAGCACCACAGAGCAGG - Intronic
1077000354 11:319253-319275 GGTCCCCAGCACCACAGAGCAGG + Intergenic
1077534992 11:3119743-3119765 GGGCCACAGGGCCACCAGGTGGG + Intronic
1077549962 11:3195815-3195837 TGGCCCCAGGGCCACCTAGGTGG - Intergenic
1078098216 11:8313368-8313390 TGTCCCCAGGCCCAGAAAGCGGG + Intergenic
1078851387 11:15167299-15167321 AATCCCCAGGCCCATCAAGCAGG - Intronic
1080605792 11:33863995-33864017 CTTGCCCAAGGCCACCAAGCTGG + Intronic
1081464262 11:43301782-43301804 TGTCACCAGGGCCACACAGCTGG - Intergenic
1082990495 11:59203504-59203526 TGTCCCCAGGGCCTTCCAGCAGG - Intronic
1083868535 11:65471997-65472019 GGCCCCCAGGGCCAGCATCCTGG - Intergenic
1083961098 11:66015526-66015548 GCTCCCATGTGCCACCAAGCAGG + Intergenic
1084084943 11:66850702-66850724 GGCCACCAGGGCCCCCATGCTGG + Exonic
1084106753 11:66985441-66985463 TGTCCCCAGGGTCACTCAGCAGG - Intergenic
1084516120 11:69638889-69638911 GGACCCGGGGGCCGCCAAGCAGG + Intergenic
1084538876 11:69774628-69774650 GGTTCCCGGGGCCCCCGAGCAGG + Intronic
1084589970 11:70084877-70084899 GGTACTCAGGGCCACTGAGCTGG + Intronic
1084689185 11:70715265-70715287 TGTGCCCAGGGTCACCCAGCCGG + Intronic
1084766604 11:71313220-71313242 GGTCTCCAGGTGCACCAAGAAGG - Intergenic
1085685327 11:78616643-78616665 GGTCACCAAGGCCCCCAGGCTGG + Intergenic
1089848707 11:121479133-121479155 AGCCCCCAGGGCCAGCCAGCTGG - Intronic
1089925528 11:122253594-122253616 TGTCCCCAGGGCCACCCATTGGG + Intergenic
1091311331 11:134577131-134577153 CTTCCCCAGGCCCACCCAGCAGG - Intergenic
1091390990 12:125912-125934 GGTACCCAGGGCCTCCTAGGGGG + Exonic
1095094418 12:38138203-38138225 GGTCCCCAGGGGCAACAGGAGGG - Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096603148 12:52744850-52744872 GGTACCCAGGGTCTCCAAGGGGG - Intergenic
1096765503 12:53885438-53885460 GGTCCCCAGGCCCACAAACTTGG - Intergenic
1096865720 12:54561516-54561538 GAGCCCCAGGGCCCCCAAGAGGG - Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1097237169 12:57548516-57548538 GGTCCCCAGGGGCTCCAAGGTGG - Intergenic
1101946286 12:109139817-109139839 AGGCCCCAGGGCCAGCAAGCTGG + Exonic
1102464203 12:113119074-113119096 GCTCCCCAGTGCCTCCAAGGGGG - Intronic
1102507434 12:113392555-113392577 GGTCAACAGGGCCACCAACCAGG - Exonic
1102541064 12:113619536-113619558 TGTCCCCATGGCCACCAACCAGG + Intergenic
1103503390 12:121422967-121422989 TGTTCCCAGGGCTACAAAGCTGG + Intronic
1103900437 12:124301038-124301060 GGTCCCCATGGCCCCCTGGCAGG + Intronic
1109395607 13:61754568-61754590 GGTACCCAGGGACACAAAGACGG - Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1114055552 14:18964836-18964858 GGTGCCCTGGGACACAAAGCTGG + Intergenic
1114106994 14:19436927-19436949 GGTGCCCTGGGACACAAAGCTGG - Intergenic
1116190775 14:41662628-41662650 GGTCAGCAGGGCCACCAATCAGG + Intronic
1117176594 14:53152639-53152661 GGGCCGCCGGGCCGCCAAGCCGG + Exonic
1118091529 14:62485622-62485644 GATTCCCTGGGCCATCAAGCTGG - Intergenic
1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG + Intronic
1119378582 14:74214439-74214461 GGGCCCCAGGGCCTCTCAGCTGG - Intergenic
1121173051 14:91870422-91870444 GGGCTGCAGGGCCACCATGCAGG - Intronic
1122071427 14:99207908-99207930 CTTGCCCAGGGCCACCCAGCTGG - Intronic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1122776550 14:104119383-104119405 GGTCCCCAGGGCCAGCCTACAGG - Intergenic
1122784627 14:104157992-104158014 GGTCCCCAGGGGCCCACAGCCGG - Intronic
1124494971 15:30180782-30180804 CTTCTCCAAGGCCACCAAGCTGG - Intergenic
1124748596 15:32357863-32357885 CTTCTCCAAGGCCACCAAGCTGG + Intergenic
1125482974 15:40093159-40093181 CTTTCCCAGGGCCACCATGCAGG + Intronic
1126466005 15:48962505-48962527 GCTCCCCAGGGCCAGGAAGCGGG + Exonic
1126670334 15:51110351-51110373 GTTCCTCAGCCCCACCAAGCAGG - Intergenic
1127606360 15:60591984-60592006 GGTCCCCAGGGCCCGCACCCGGG - Intronic
1127856796 15:62960150-62960172 GGAGCCCAGGCCTACCAAGCTGG - Intergenic
1129312002 15:74719343-74719365 GGTCCCCAGGTCATCCAGGCTGG - Intergenic
1129412358 15:75356922-75356944 GGGGCACAGGGCCACCAAGTGGG - Exonic
1129676879 15:77636535-77636557 GCTCCACAGGGCCCCCCAGCTGG - Intronic
1130546112 15:84858346-84858368 GGTCCCCAGGGACTCCAGGGCGG + Exonic
1131997364 15:98145103-98145125 GGTTCTCAGGGCCACCATGATGG - Intergenic
1132035571 15:98481029-98481051 GGTCCCCAGGGCCATGGACCAGG + Intronic
1132088982 15:98932442-98932464 CGTCCCCAGTGCCACCAGCCAGG - Intronic
1132458371 16:36747-36769 GGTCTCCACGTCCACCAAGAAGG + Intergenic
1132746454 16:1438331-1438353 ACTCCCCATGGCCACCAAGATGG + Intronic
1133428080 16:5710752-5710774 GGTCCCCAGGGACACAGAGCCGG - Intergenic
1134337820 16:13317591-13317613 GGTTCCCAGGGTCACCCAGAGGG - Intergenic
1134501546 16:14772642-14772664 GGTCCCTATGGCCACCTAGCAGG - Intronic
1135374542 16:21934328-21934350 GGTCCCTATGGCCACCTGGCAGG - Intergenic
1136003195 16:27311818-27311840 GGTCCTCAGGGCTAGGAAGCAGG + Intergenic
1136154924 16:28376176-28376198 GGTCCCTATGGCCACCTGGCAGG + Intergenic
1136171726 16:28494146-28494168 GCACCCCAGAGCCACCAATCCGG + Intronic
1136208167 16:28739082-28739104 GGTCCCTATGGCCACCTGGCAGG - Intergenic
1136264251 16:29105715-29105737 GGTCCCTATGGCCACCTGGCAGG - Intergenic
1136296781 16:29308505-29308527 GGTCTCCAGCGACACCAAGCTGG - Intergenic
1138436026 16:57000520-57000542 CATCCCCAGGGCCGCCAGGCAGG + Intronic
1139484749 16:67249154-67249176 GATCCACAGGGCCACCAGGTAGG - Exonic
1139601891 16:67992325-67992347 GGTCTTCCTGGCCACCAAGCTGG + Intronic
1139947377 16:70650474-70650496 GGTCCCCAGGGCCCCAGAACGGG + Intronic
1140759763 16:78100054-78100076 GGACCCGAGGCCCACCAAGGGGG - Intronic
1141627924 16:85271216-85271238 GGGTCCCAGAGCCCCCAAGCAGG + Intergenic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1142130989 16:88431370-88431392 TGCCCCCAGGACCACCCAGCAGG - Exonic
1142291637 16:89195975-89195997 GGCTCCCAGGGCCACCAGGCAGG + Exonic
1142403136 16:89871498-89871520 GGTGGCCAGGACCACGAAGCTGG - Intergenic
1142671029 17:1487482-1487504 GGTCCCCAGGGCCGCCGCTCCGG - Intronic
1142755845 17:2015939-2015961 GGACTCCAGAGCCTCCAAGCTGG + Intronic
1143548625 17:7614932-7614954 GGCCCCGAGGGCCACCGCGCAGG + Intronic
1143609212 17:8007923-8007945 ACTCCCCTGGGCCACCTAGCAGG - Exonic
1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG + Intronic
1144501137 17:15787214-15787236 GGACCCCAGGTCCATCCAGCGGG + Intergenic
1145163304 17:20589888-20589910 GGACCCCAGGTCCATCCAGCGGG + Intergenic
1145255861 17:21322007-21322029 CGTCCCCAGGACCTCCAACCAGG - Intergenic
1145320760 17:21765939-21765961 CGTCCCCAGGACCTCCAACCAGG + Intergenic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1146393559 17:32444309-32444331 GCTCCCCAGCGCCTCCTAGCGGG - Exonic
1146573673 17:33973853-33973875 GAGGCCCAGGGCAACCAAGCAGG - Intronic
1147667931 17:42160335-42160357 GGTCCCCCAGGCCACCCAGCAGG - Exonic
1147870193 17:43581766-43581788 GGACCGCAGGCCCACCCAGCAGG - Intergenic
1147915592 17:43883398-43883420 GGAGCCCTGGGACACCAAGCAGG + Intronic
1147978893 17:44262801-44262823 GGTCCCCAGAGCCTCCAGGTGGG + Intronic
1147980790 17:44272792-44272814 GGTCCCCAGGGAGACCATGCTGG + Intergenic
1148342048 17:46878996-46879018 AGTCCCCAGGGGCCCCAAGAGGG - Intronic
1148862150 17:50610034-50610056 GGTCCCTGGGGCCCCCAAGAGGG + Intronic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1150646970 17:66984861-66984883 GGTCCCCAGGGTTACCAGGCTGG + Intronic
1151112132 17:71690865-71690887 GGACCACATGGCCACCTAGCTGG - Intergenic
1152519199 17:80845519-80845541 GCTCCCCAGGGGAACCAGGCAGG - Intronic
1152649311 17:81484568-81484590 GGTCCCAAGGCCCACCCAGGAGG - Intergenic
1153223602 18:2881862-2881884 GGTCCCCACCACCACCTAGCAGG - Intronic
1155801009 18:30102881-30102903 AGTCAGCAGGGCAACCAAGCAGG + Intergenic
1156474547 18:37397428-37397450 GGTACCCAGGGCAACCCAGATGG - Intronic
1157626117 18:49052634-49052656 GGGGCCCTGGGCCACCAAGAGGG - Intronic
1157872789 18:51245997-51246019 GGTCCACAGGCCCACCGATCGGG - Intergenic
1160865359 19:1253714-1253736 AGTCACCAGGGCCAGCAAGTGGG - Intronic
1160897214 19:1408364-1408386 GGTCCCCCTGGCCAGGAAGCCGG - Intronic
1160947434 19:1650287-1650309 TGTCCCCACATCCACCAAGCAGG - Exonic
1161433094 19:4245570-4245592 GGTCACCATGGCCACCATGGTGG - Intergenic
1161470774 19:4455880-4455902 AGTGCCCAGGGCCTCCAAGGAGG - Intronic
1161487732 19:4544561-4544583 GATGCCCAGGGCCACCCCGCCGG - Intronic
1162281341 19:9700353-9700375 TGTCTCCAGGACCCCCAAGCAGG + Intronic
1162301946 19:9849350-9849372 GGACCCCAGGGCCCCCAATCTGG - Exonic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1162762628 19:12897509-12897531 GGTCCCCAGGGCCACCAGGCAGG - Intronic
1163129659 19:15264661-15264683 GGAGCCCAAGACCACCAAGCTGG - Exonic
1163356881 19:16818818-16818840 TGTCCCCAGGGCCAGGAAGAGGG - Intergenic
1163534326 19:17868547-17868569 GATGTCCAGGGCCACCCAGCAGG + Intergenic
1164502184 19:28829300-28829322 TGTCCTCAGGGTCACCAGGCAGG - Intergenic
1164518245 19:28955034-28955056 GGTCTCCCGGGGCACAAAGCAGG - Intergenic
1164583983 19:29454189-29454211 GGTCCACAGACCCACCAAGTGGG + Intergenic
1165069068 19:33245104-33245126 AGTTCCCAGGACCATCAAGCAGG - Intergenic
1165153971 19:33776678-33776700 GGCCCACAGGGGGACCAAGCTGG - Intergenic
1165213627 19:34254412-34254434 GGGACCCTGGGCCCCCAAGCGGG - Intergenic
1165964993 19:39569577-39569599 GTTGCCCAGGGCTGCCAAGCAGG + Intergenic
1166194891 19:41198946-41198968 GGTCCCCAGGGACACCTGGCTGG - Intronic
1166338861 19:42125439-42125461 TGTCCCCAGGGCCAGGAAACAGG - Intronic
1167369158 19:49070657-49070679 GGTGCCCAGTGCCACAAAGTAGG + Exonic
1167467771 19:49659148-49659170 AGTGCCCAGGGTCACCAGGCAGG + Intergenic
1168113455 19:54207956-54207978 GGGTCCCAGGGCCAGCAGGCAGG - Intronic
1168549874 19:57283874-57283896 GGTCCCCAAGGTCACATAGCAGG + Intronic
924988076 2:288766-288788 GGTCCCCAAGGGCTCCGAGCGGG + Intronic
925160617 2:1681119-1681141 GGTCCCCAGGCCCCTCCAGCCGG + Intronic
926630419 2:15130609-15130631 GGGCCACAGGGCCCCCAAACTGG + Intergenic
927651440 2:24915896-24915918 GGTTCCCAGGCCCACCCACCAGG - Intronic
932160473 2:69455211-69455233 GTTCCACAGGGCTACCATGCTGG - Intergenic
937359285 2:121217804-121217826 GGTCCCCAGGAACAGGAAGCAGG + Exonic
937449824 2:121992888-121992910 GGTCAACAGGGCCACCTAGGGGG - Intergenic
937466708 2:122139443-122139465 GGACCCCAGGCCCACCACGGTGG + Intergenic
938065564 2:128280311-128280333 GCTCTCCAGGGCCACAAGGCCGG + Intronic
947385682 2:229587759-229587781 GGTGCCCAGGAGCACAAAGCTGG - Intronic
948182868 2:235996595-235996617 GGTCCCCGGGGGCAGCCAGCTGG - Intronic
948587455 2:239028208-239028230 GGTCCCCTGGGCTGCCCAGCAGG - Intergenic
1169357261 20:4917671-4917693 GGTCCCCAGGGACAGACAGCTGG - Intronic
1170597752 20:17818343-17818365 GGAGCCCAGGGCCACCACACGGG - Intergenic
1172039969 20:32036847-32036869 CGTCCCCAGGGCCCCCCACCTGG + Intergenic
1172164919 20:32893276-32893298 CCTCCCCAGGGCCTCCAAGTGGG + Exonic
1172484271 20:35288868-35288890 GGTACACAGGGACACCACGCCGG + Exonic
1172783544 20:37451320-37451342 TGTCACCAGGGCAACCATGCTGG - Intergenic
1172961636 20:38804686-38804708 GCACCCCAGGGCCAGCCAGCTGG - Intergenic
1173837938 20:46138108-46138130 GTTCCCCAGTGCCACTCAGCTGG + Intergenic
1175822005 20:61915066-61915088 GGTCCTCACGCCCACCAAGGAGG + Intronic
1175883490 20:62274172-62274194 AGTCCCCAGGGCAACCAGGTGGG - Intronic
1175905530 20:62377756-62377778 GGGCCTCACGGCCACCCAGCAGG - Intergenic
1175907242 20:62386928-62386950 GCGCCCCAGGGCCAGCAGGCTGG + Intergenic
1176108598 20:63401011-63401033 GGTCCCCGGGGCTACCAGGCAGG - Intergenic
1176138559 20:63535676-63535698 GGACCCCAGGGGCTCCATGCTGG - Intronic
1176148855 20:63578771-63578793 TGTCCCCAGCGTCACGAAGCAGG + Intergenic
1180159861 21:45994205-45994227 GGTCTCCAGGGACACCAACGGGG - Exonic
1180161130 21:45999201-45999223 GGTCCCGAGGGCCCCCAGGTGGG + Exonic
1180474029 22:15687388-15687410 GGTGCCCTGGGACACAAAGCTGG + Intergenic
1180917697 22:19500221-19500243 GTTCCAAAGGGCCACCAACCAGG - Intronic
1181068615 22:20319113-20319135 GGCTCCCAAGCCCACCAAGCAGG + Intronic
1181646181 22:24232794-24232816 GGAACCCAGGGCCACCATGTGGG + Intronic
1182145656 22:27995263-27995285 GGACCCCAGGGCCTCCTTGCAGG - Intronic
1182304151 22:29356359-29356381 GGTCCTCAGGGGCTCCAACCAGG - Intronic
1182994834 22:34802563-34802585 GGTGCCCATGGCCACACAGCTGG + Intergenic
1184027866 22:41871342-41871364 GGACCCTAGGGCCACCAGGCAGG + Intronic
1184151764 22:42643651-42643673 CATGCCCAGGGCCACCCAGCTGG + Intronic
1184224530 22:43121602-43121624 GGTCTCCAGGAGCACAAAGCAGG + Intronic
1184564722 22:45285143-45285165 GGTCCCCAGCGCCAGGAATCAGG - Intronic
950222650 3:11207795-11207817 GCTCCCTAGGGCCTCCAAGTAGG - Intronic
950518167 3:13480536-13480558 CGTCCCTCGGGCCACCGAGCAGG - Intronic
950643257 3:14361783-14361805 AAGCCCCAGGGCCACCCAGCTGG - Intergenic
950788471 3:15454349-15454371 GCTCCCCAGGGACACAAGGCTGG - Intronic
951333533 3:21393863-21393885 GGTACCCAGGGTTGCCAAGCCGG - Intergenic
952902950 3:38121677-38121699 GGTCCCAAAGTCCACCCAGCTGG - Exonic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953481668 3:43257353-43257375 TGTCTCCAGGGCCACCCAGCAGG - Intergenic
954438343 3:50507946-50507968 GGTCCCCAAGGGCCCCCAGCTGG + Intergenic
960050032 3:113230444-113230466 GGACCCCAAGACCAGCAAGCAGG + Intronic
960192800 3:114727192-114727214 GGAGCCCAGGCCCACCAACCTGG + Intronic
960688189 3:120314535-120314557 GGTCCCCAAGGTCACCAAATAGG + Intergenic
961445426 3:126978815-126978837 GGTCCCCATGTCCTCCAGGCAGG + Intergenic
961773640 3:129268415-129268437 GGACCCCAGGGCCTCCATGGTGG + Intronic
964240326 3:154585405-154585427 GGTTGCCAGGGGAACCAAGCAGG + Intergenic
965604415 3:170484648-170484670 GGAGCCAAGGGCCACCAAGGAGG + Intronic
968090478 3:195895690-195895712 GGGCCCCAGAGCCACCAACTGGG + Intronic
968480051 4:829240-829262 GGACCCCAGGAGCACAAAGCAGG + Intergenic
968873647 4:3254088-3254110 GCTCCCCAGGCCCACCCCGCAGG - Intronic
969258740 4:6020863-6020885 TTACCCCAGGGCCACCAAGGAGG + Intergenic
969492704 4:7509251-7509273 GGGGGCCAGGGCCACCTAGCAGG + Intronic
969496080 4:7527082-7527104 GGTCCCCAGGGCCACAGAGAGGG - Intronic
969497904 4:7536522-7536544 GTTCCCTAGGACCACCATGCAGG - Intronic
969700722 4:8766217-8766239 AGTCCCCAAGGCCACCAACCTGG + Intergenic
971099258 4:23444965-23444987 TTTCCCCAGTGCAACCAAGCAGG + Intergenic
972630242 4:40836060-40836082 GGTGACGAGGCCCACCAAGCAGG + Intronic
978379403 4:108111351-108111373 GGTCCCCAGGTACACTCAGCAGG - Intronic
980541381 4:134201199-134201221 AGTCCCCACAGCCACCAATCTGG + Exonic
980932391 4:139194353-139194375 GGTCCCTAGGGACACGAAACGGG + Intergenic
981936976 4:150249290-150249312 GGTCTCCCGGGACACAAAGCAGG - Intronic
982045769 4:151444068-151444090 GCTCTCCAAGGCCACCAAGGAGG - Intronic
984256077 4:177391531-177391553 TTTGCCCAGGGCCACCGAGCTGG - Intergenic
985385301 4:189439895-189439917 GATCCCCAGGACCACAAAGCTGG - Intergenic
985634948 5:1031267-1031289 GGACCCCAGGGCTGCCCAGCTGG - Intronic
985703093 5:1385561-1385583 CCTCTCCAGGGCCACCAAGAGGG + Intergenic
986258416 5:6121492-6121514 GTTCCCCAAGGCCACACAGCTGG + Intergenic
986668592 5:10124476-10124498 GTTCCCCAAGGCCAGCAACCCGG + Intergenic
988717281 5:33840736-33840758 GATCCCCAGGGCCACCCTGCAGG + Intronic
989480601 5:41925725-41925747 GGTCCCCAGGGGCCCCATGAAGG - Intronic
991035693 5:62125069-62125091 GCTTCCCAGGGCCCTCAAGCTGG + Intergenic
991693782 5:69250666-69250688 CTTCCCCAGGGCAACCAAGCTGG + Intronic
992071240 5:73151235-73151257 GGTCCCCAGGGCCCACAAAGCGG - Intergenic
992093253 5:73338331-73338353 GATCCCCAGGGCTCCCAGGCAGG + Intergenic
992665116 5:79000788-79000810 GGATCCCAGGGACACAAAGCAGG + Intronic
994384076 5:99107629-99107651 TTTCCCCAAGGCCACCAAACTGG + Intergenic
995541301 5:113188775-113188797 TGTGCCCAGGGCCACACAGCTGG + Intronic
997596390 5:135109980-135110002 GCACCCCAAGGCCACAAAGCTGG - Intronic
1000281612 5:159787188-159787210 TGTCCTCAGGGCCGACAAGCAGG + Intergenic
1001535764 5:172496897-172496919 GGTCCCCAGGAGCAGCAAGTCGG + Intergenic
1001550776 5:172600906-172600928 GGTCCCTAGGGCGACCATCCTGG - Intergenic
1002280011 5:178124410-178124432 TGGCCCCAGAGCCACCCAGCCGG - Exonic
1002493685 5:179597785-179597807 TGCCCCCAGGGCCACTCAGCTGG + Intronic
1003188087 6:3849996-3850018 GGTCACCAGGCCCACCGTGCTGG - Exonic
1003516662 6:6824082-6824104 GGACCCGTGGGCCACCGAGCAGG - Intergenic
1004627853 6:17393725-17393747 GGACCCCAGGGCAGCGAAGCAGG + Exonic
1005994985 6:30925589-30925611 GGTGCCCAGGGGCTCCAAGAAGG - Exonic
1006513719 6:34534758-34534780 GGTCCTCAGGGCCCCAGAGCGGG + Exonic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1007386738 6:41525084-41525106 GGTCCCCAGTGCCTCTATGCTGG - Intergenic
1007752488 6:44078862-44078884 TGTGCCCAAGGTCACCAAGCTGG - Intergenic
1009029335 6:58037508-58037530 TGTCGCCAGGGTCACCAGGCTGG - Intergenic
1009204878 6:60788902-60788924 TGTCGCCAGGGTCACCAGGCTGG - Intergenic
1010900909 6:81426130-81426152 AGTCCCCTTGGCCACCAAGAAGG - Intergenic
1012618760 6:101313130-101313152 AGTCCCCTACGCCACCAAGCTGG - Intergenic
1013233120 6:108174788-108174810 GGTCCCCAGGGCCTTTAGGCTGG - Intronic
1017021574 6:150143729-150143751 CCTCCCCACGGCCACCAAGGGGG - Intronic
1017819811 6:158041175-158041197 TGTGCCCAGGGCCACCCTGCTGG + Intronic
1018264524 6:162008317-162008339 GGGCCCCCGGGGCACGAAGCAGG - Intronic
1018746559 6:166766919-166766941 GGCCCACAGGGCCACGCAGCTGG - Intronic
1018813291 6:167313200-167313222 GGTCCCCAAGTCCTCCATGCTGG + Intronic
1019321156 7:415901-415923 GCTCTCGAGGGGCACCAAGCAGG + Intergenic
1019361518 7:607207-607229 GGTCACCTGGACCACCAGGCTGG + Intronic
1019443943 7:1061249-1061271 CCTCCACAGGGCCACCCAGCAGG - Intronic
1019597665 7:1865825-1865847 GGTGCACAGGGCCTGCAAGCAGG - Intronic
1019667223 7:2257917-2257939 GCTCCCCAGGACCACCAGCCAGG + Intronic
1020278451 7:6637917-6637939 GGCCCCCAAGGTCACAAAGCGGG - Exonic
1022532397 7:31075201-31075223 GGTTCCCAGGGACACCTAACTGG + Intronic
1025812676 7:64885096-64885118 GGTCCCCTGGTCCACCAAGAGGG - Intronic
1027235600 7:76295784-76295806 TGGCCCCAGGGTCACAAAGCTGG - Intergenic
1032192634 7:129773400-129773422 AGTCCCCAGGGCACCCAGGCAGG + Intergenic
1034534115 7:151716368-151716390 GGTGCCCAGGGTCACAAAGGGGG - Intronic
1034830785 7:154305696-154305718 AGCCCCCTGAGCCACCAAGCTGG + Intronic
1034838497 7:154374197-154374219 TGTCCCCAAGGTCACCCAGCAGG - Intronic
1035239808 7:157522233-157522255 GGTGCTAAGGGGCACCAAGCTGG - Intergenic
1035388667 7:158490628-158490650 GGGCCCCAGGGCCACTAGGCGGG + Intronic
1036751313 8:11445237-11445259 GGTCCCCAGAGCCAGCCAGCAGG + Intronic
1037822016 8:22139642-22139664 GGTGCCCAGAGCCACAAATCCGG + Intronic
1038446594 8:27608840-27608862 GGTCACCATGGCAACCCAGCAGG + Intronic
1038755548 8:30337232-30337254 TTTTCCCAGGGCCACAAAGCTGG + Intergenic
1039759459 8:40558764-40558786 GGTCCCCTCGGCCAAGAAGCGGG - Intronic
1044648968 8:94474805-94474827 GGCCCCCGGGGCCAGCAACCAGG + Intronic
1047787978 8:128172646-128172668 GGTGCTCAGGGCCACATAGCAGG - Intergenic
1047928647 8:129704675-129704697 GGTCCCCAGGCCCTCCAACCTGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049247184 8:141569111-141569133 GGTCCCCAGAACCCCCAACCAGG - Intergenic
1049290500 8:141798996-141799018 GGCCGCCAGGACCAGCAAGCAGG - Intergenic
1049344137 8:142129423-142129445 GGTCCCCAGGGCCACACGGCTGG - Intergenic
1049377111 8:142294527-142294549 GGTGCCCACGGCCACACAGCAGG - Intronic
1049451811 8:142666043-142666065 CCTCCCCATGGCCTCCAAGCCGG - Exonic
1049599313 8:143499729-143499751 GGTCCCCAGGGCCTCCGTGGAGG - Intronic
1049850501 8:144827707-144827729 CGTCCCCCGGGCCTCCAGGCGGG + Intronic
1054769517 9:69070441-69070463 GGCCACCAGGGCCACCAGGAGGG + Intronic
1057030336 9:91770161-91770183 AGTCCCCAGGGCCACCATGAGGG - Intronic
1057868735 9:98702092-98702114 CCTCCCCAAGGTCACCAAGCAGG + Intronic
1057897349 9:98919893-98919915 CTTCCCCAGGGCCATCCAGCAGG + Intergenic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1060219367 9:121756251-121756273 TTTCCCCAGGGCCACACAGCAGG + Intronic
1060398245 9:123331503-123331525 GTTGCCCAGGGCCACACAGCTGG - Intergenic
1060932060 9:127495441-127495463 GGTCCCCAGGGCTCCCTGGCCGG - Intronic
1060936089 9:127517093-127517115 GGGCCCCAGGCCCACCCACCTGG + Exonic
1061412175 9:130427684-130427706 GGTCCCCAGGGCCAGGACCCTGG + Intronic
1062009171 9:134258111-134258133 GGTACTCGTGGCCACCAAGCTGG - Intergenic
1062516456 9:136939420-136939442 GGTCCCCAGGGCTTCCCAGCTGG + Intronic
1062631474 9:137464974-137464996 GGGCCCCAGGCCCACCCAGAAGG - Intronic
1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG + Intronic
1186795586 X:13044232-13044254 GGTCCCCTGGGCGTCCAGGCTGG - Intronic
1187254535 X:17630179-17630201 AGTGGCCAGGGCCACCAAGCTGG - Intronic
1189751145 X:44224417-44224439 CTTCCCCAAGGCCACTAAGCTGG + Intronic
1199846507 X:151695590-151695612 GGTATCCAGGGCCAACGAGCTGG + Intronic
1200072949 X:153537991-153538013 GGTCCCCAAGGCCACAGTGCAGG + Intronic
1200119729 X:153784607-153784629 GGTCCCCAGGTCCTCCAAGAGGG - Intronic
1200323336 X:155212752-155212774 AGTCCCCAGGGCCATCATTCTGG + Intronic