ID: 1097174519

View in Genome Browser
Species Human (GRCh38)
Location 12:57135162-57135184
Sequence CCAGCCACTGATTGGAAATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097174519_1097174526 17 Left 1097174519 12:57135162-57135184 CCGTATTTCCAATCAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1097174526 12:57135202-57135224 AAGGTTAGCTCCCATCGGTCAGG 0: 1
1: 0
2: 1
3: 2
4: 39
1097174519_1097174530 28 Left 1097174519 12:57135162-57135184 CCGTATTTCCAATCAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1097174530 12:57135213-57135235 CCATCGGTCAGGGAGACCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 102
1097174519_1097174531 29 Left 1097174519 12:57135162-57135184 CCGTATTTCCAATCAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1097174531 12:57135214-57135236 CATCGGTCAGGGAGACCTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 110
1097174519_1097174527 18 Left 1097174519 12:57135162-57135184 CCGTATTTCCAATCAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1097174527 12:57135203-57135225 AGGTTAGCTCCCATCGGTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 49
1097174519_1097174524 -2 Left 1097174519 12:57135162-57135184 CCGTATTTCCAATCAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1097174524 12:57135183-57135205 GGTGGTTAGCAAGGTGAAAAAGG 0: 1
1: 0
2: 2
3: 11
4: 190
1097174519_1097174525 12 Left 1097174519 12:57135162-57135184 CCGTATTTCCAATCAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1097174525 12:57135197-57135219 TGAAAAAGGTTAGCTCCCATCGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097174519 Original CRISPR CCAGCCACTGATTGGAAATA CGG (reversed) Intronic
907641823 1:56198254-56198276 CCAGCCACTGAATGGACCTCAGG - Intergenic
908066553 1:60412428-60412450 CAACCCACTGATAGGAAATTGGG + Intergenic
912325651 1:108758330-108758352 CCAGCCAGTGATAGCTAATAAGG - Intronic
918474431 1:184908035-184908057 CCAGCAACTGGATGGAAAGAAGG + Intronic
919525734 1:198647855-198647877 GAAGCCACTGATAGAAAATACGG - Intronic
920218543 1:204378356-204378378 CCAGCCACTGAACGGAAAAGGGG + Intergenic
921284769 1:213599506-213599528 CCCCCCACTGTTTGGAAATATGG - Intergenic
923684508 1:236144474-236144496 GAAGCCACTGACTGAAAATATGG + Intronic
1063723472 10:8610003-8610025 CAAGCCACAGATTGGAAAAAGGG + Intergenic
1066612178 10:37260715-37260737 GCAGCTACTGGTTGGAAATTTGG + Intronic
1070931421 10:80263830-80263852 CCAGCCCCTGAGTGGGGATAAGG + Intergenic
1072995011 10:100235893-100235915 CAAGCCACTTAGTGGAACTAGGG + Intronic
1078358265 11:10648904-10648926 CATGCCAGTGATGGGAAATAGGG + Intronic
1079738694 11:24030596-24030618 CCTGCCACTGATTGAGACTAAGG + Intergenic
1084404535 11:68963569-68963591 CCAGACACTGTAGGGAAATATGG + Intergenic
1084535715 11:69755409-69755431 CCAGCCACTTATTGATAAGAAGG - Intergenic
1088629464 11:111760694-111760716 TCAGCCACTCATTGGTAACAAGG + Intronic
1090450819 11:126804762-126804784 TGAGCCACTGCTTGGAAAAAAGG - Intronic
1090745397 11:129701153-129701175 CCAGCCAATGATTGCAAACTGGG + Intergenic
1090853445 11:130591092-130591114 CCAGCCAGTGCTGGGAAATTTGG - Intergenic
1092920845 12:13230547-13230569 TCAGCCACCCTTTGGAAATAAGG + Intergenic
1093680752 12:21999382-21999404 TCACACACTGATTGGAAATAAGG - Intergenic
1093772170 12:23030871-23030893 CGAGCCCCTGAAGGGAAATATGG + Intergenic
1097174519 12:57135162-57135184 CCAGCCACTGATTGGAAATACGG - Intronic
1098217275 12:68233985-68234007 CCAGTCACTGTTTGGAACTGAGG - Intergenic
1100165681 12:91914924-91914946 CCAGCCACTGGTTGAAGATAGGG - Intergenic
1100727347 12:97422832-97422854 CCAGCCACTGGATTTAAATAAGG - Intergenic
1101292687 12:103387652-103387674 CAAGCCACTGCTAGGATATATGG - Intronic
1104597312 12:130128562-130128584 ACAGACACTGATGGGAAAAATGG - Intergenic
1108955377 13:56149460-56149482 CCAGCCACAGACTGGAAAACCGG + Intergenic
1110898879 13:80795004-80795026 GCAGCCACTGACTAGAGATATGG - Intergenic
1113745172 13:112739347-112739369 CCAGCCAATGAATGAAAAGATGG + Intronic
1116178466 14:41505072-41505094 CCAGCCACTACATTGAAATAAGG + Intergenic
1118980259 14:70710458-70710480 CAAGCCACTGATTTCAAAGAGGG + Intergenic
1120038834 14:79729327-79729349 CCTCCCACTGATTGGAAAATAGG - Intronic
1121343403 14:93118002-93118024 CAAGCCATTGATTAGAAACACGG + Intergenic
1122742318 14:103879422-103879444 CCAAACACTGAATGTAAATACGG + Intergenic
1128214117 15:65922630-65922652 CCAGCTACTCAATGGAAACAGGG - Intronic
1130769122 15:86906732-86906754 ACATCTTCTGATTGGAAATAGGG + Intronic
1131098340 15:89669880-89669902 CCAGCCACTGCTCTGGAATAGGG - Intronic
1134283381 16:12838149-12838171 CCAGCCACTCTATGGGAATATGG - Intergenic
1136514788 16:30761710-30761732 CCAGCCACTTTTTGGGAATGAGG - Exonic
1140137831 16:72223511-72223533 CCAGCCACTGACTGGTCATAAGG - Intergenic
1141287120 16:82682867-82682889 CCAGCCACAGTTAGGAATTAAGG + Intronic
1141708770 16:85685305-85685327 CCAGACACTGATTTTAAACAAGG + Intronic
1143756779 17:9073171-9073193 CCAGCCACTGTTTGCAAATGCGG - Intronic
1149400827 17:56294239-56294261 CCAGCCACTGGAGGGAAACAGGG - Intronic
1151251481 17:72839086-72839108 AAAGCCAGTGATGGGAAATAAGG + Intronic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1154454814 18:14510979-14511001 CCACCCAGTGATTAGAAATGTGG + Intronic
1160209502 18:76864739-76864761 CAAGACTCTGAATGGAAATAAGG + Intronic
1160254454 18:77235988-77236010 CCAGCCACTGATTGCCAGGAAGG - Intergenic
1161788997 19:6347501-6347523 CGAGCCACTGTGTGGAAACAGGG + Intergenic
1165044798 19:33096326-33096348 CCAGGCACTGTTTGGAACTTCGG + Exonic
927843198 2:26457981-26458003 CAAGCCACTGAAAGGAAATGCGG + Exonic
928125154 2:28610566-28610588 CCAGCCACTCATTGCACACATGG + Intronic
928898288 2:36290543-36290565 CCAGCTACTGATTGTCAGTATGG + Intergenic
931803822 2:65785409-65785431 TCAGCTACTGATTTGAAATGAGG - Intergenic
934109593 2:88729658-88729680 CTTGCCACTAAGTGGAAATAAGG + Intronic
944034958 2:195283548-195283570 CCAGCCACGGAATGAAAAGAAGG + Intergenic
944642393 2:201741290-201741312 CCAACTGCTGATTGTAAATATGG - Intronic
945265163 2:207883422-207883444 CCACCAAATAATTGGAAATAAGG + Intronic
946005579 2:216521900-216521922 ATTTCCACTGATTGGAAATAAGG + Intronic
946483934 2:220082675-220082697 CCAGCCACTGCTCGGCAATGAGG + Intergenic
946518915 2:220444969-220444991 CCAGGCACTGATTGGACCAAAGG - Intergenic
947563357 2:231177283-231177305 CCAGGCAATGAATGAAAATACGG - Intergenic
948126780 2:235569817-235569839 TCAGCTACTGATTGGCAATGGGG - Intronic
1169053960 20:2604659-2604681 CCAGCCAGTGATTAGAAAATTGG + Intronic
1171882585 20:30629357-30629379 TCACCCACTGATTAGAAATGTGG + Intergenic
1173459238 20:43229558-43229580 CCAGGCACTGATGGGAGAAATGG + Intergenic
1176819350 21:13642329-13642351 CCAGCCAGTGATTAGAAATGTGG - Intergenic
1182056392 22:27358595-27358617 AGAGCCACTGATTGGAAAATGGG + Intergenic
1182277952 22:29202237-29202259 CCAGGCACTGCTTGGCAATTAGG + Intergenic
1184625018 22:45719947-45719969 CCAACCACTGACTGGAAATGTGG - Intronic
949175394 3:1055832-1055854 CCAGACACTGTTTGGATAAAAGG - Intergenic
950710955 3:14812293-14812315 CCAGCCACTGCTTGGAAAGGGGG + Intergenic
952278124 3:31897224-31897246 GAAACCACTGATTGAAAATATGG + Intronic
953730540 3:45443712-45443734 CCCGCCAGTGATTGGAATAATGG + Intronic
959474230 3:106790124-106790146 GCAGCCACTGCTGGGAGATAGGG - Intergenic
959592367 3:108094250-108094272 TCAGACACTGATTGAAGATATGG - Intergenic
963953799 3:151230874-151230896 CTAGCCACTGAAAGGAAACAGGG + Intronic
966083887 3:176042775-176042797 CAAGCCACTGATTGGCAGTTGGG + Intergenic
967846735 3:194049491-194049513 CCAGCCACTCAATGTAAAAATGG - Intergenic
972457316 4:39267267-39267289 CAAGTCACTGATTGGAAACGAGG + Intronic
972639935 4:40916225-40916247 TCAGCCACAGACTGGAATTAAGG + Intronic
973259279 4:48145042-48145064 TCAGCCAATGAGTGGGAATATGG + Intronic
977774090 4:100896807-100896829 CTAACCACTACTTGGAAATAGGG + Intergenic
983793812 4:171833909-171833931 TCAACCACTGTTTGAAAATACGG + Intronic
986042197 5:4004647-4004669 CCAGTGGCTGATTAGAAATAGGG + Intergenic
986116051 5:4775894-4775916 AGAGCCACTGTTTTGAAATACGG - Intergenic
988555123 5:32229847-32229869 CCAGCCACTGGTGGGTAAGACGG + Exonic
993090401 5:83418896-83418918 CCAGGAGCTGAATGGAAATACGG - Intergenic
995451290 5:112303925-112303947 CCAAACACTGACTGGAAAGAGGG + Intronic
997661825 5:135595081-135595103 CCAGGGACTGTTTGGAAATGAGG - Intergenic
998365109 5:141625359-141625381 CCAGATACTGGTTGGAAATGAGG + Exonic
999666394 5:153917334-153917356 CTAGCCAGTCATTGGCAATAGGG - Intergenic
1001501977 5:172244138-172244160 CCAACAACTGAATGGATATATGG + Intronic
1001647347 5:173291981-173292003 CCAACCCCTGATTGGACAGATGG + Intergenic
1001725877 5:173899564-173899586 CCAGCTAGTGATTCGAAATTTGG + Intronic
1002600239 5:180350232-180350254 CCAGGCCCTATTTGGAAATAAGG + Intronic
1003756312 6:9125000-9125022 CCAGCTAGTTATTGGAATTAGGG - Intergenic
1004378094 6:15108283-15108305 CCAGATGCTGATTGGAAATCCGG + Intergenic
1005504447 6:26457840-26457862 CCAGCAACTGCTGAGAAATAAGG + Intergenic
1010345805 6:74809487-74809509 GAAGCCACTGAATAGAAATAAGG - Intergenic
1010799058 6:80152970-80152992 CCAAGCACTGCTTGGAAATGAGG - Intronic
1013348366 6:109284095-109284117 CCATCCACACATTGGAAATGTGG - Intergenic
1015334263 6:132019282-132019304 ACAGCCCCTAATTGGAAAAACGG - Intergenic
1016451537 6:144187645-144187667 CCAGCCTGTGCTTGGAAAGATGG + Exonic
1017276556 6:152576251-152576273 CCAACTACAGATTGGGAATAAGG + Intronic
1020502256 7:8938220-8938242 TCAGCCTCTGATTGGTCATAGGG - Intergenic
1021430783 7:20556537-20556559 CAAGCCTCTGCTTGGAAATAGGG - Intergenic
1021539187 7:21737885-21737907 CCAGCAAGTGTTTGGAAATGTGG + Intronic
1024528762 7:50373051-50373073 TCAGCCACTCATTGGACAAATGG - Intronic
1024555870 7:50603271-50603293 CCAGCCACAGTGTGGATATAGGG - Intronic
1026919715 7:74146337-74146359 CCAGCCACTGTTTGGTCAGAAGG + Intergenic
1029335090 7:99892161-99892183 CCAGTGACTGATAGGAAATGAGG - Exonic
1029464136 7:100714907-100714929 GAAGCCACTGCTTGGAAATGAGG + Intergenic
1031954277 7:127926372-127926394 CCAGTCACTAAGTGGAAAGATGG - Intronic
1034949609 7:155288089-155288111 CCAGCCACAGACTGGAGATCAGG - Intergenic
1038370692 8:26986765-26986787 GCAGCCCCTGATTGAAAAGAGGG - Intergenic
1039350228 8:36756239-36756261 CCAGCCACTGATTCAACAGAAGG - Intergenic
1043241435 8:77939856-77939878 CCAGTCATTTATTTGAAATAAGG + Intergenic
1044145985 8:88714417-88714439 GCAGCCACTTCTGGGAAATAAGG + Intergenic
1044331978 8:90931284-90931306 TCAGCCACTGTTTGGCAATTGGG - Intronic
1047169241 8:122474918-122474940 TCAGCCACTGACTCTAAATATGG + Intergenic
1048379005 8:133847395-133847417 CCAGACAGTGATGGGACATACGG - Intergenic
1050779071 9:9307512-9307534 ACAGCCACTGATTGGATGTTAGG - Intronic
1059044403 9:110850290-110850312 TCTACCACTGAATGGAAATAGGG - Intergenic
1203528008 Un_GL000213v1:107241-107263 CCAGCCAGTGATTAGAAATGTGG + Intergenic
1186648413 X:11532532-11532554 CCAGCCTCTGGCTGGAAGTAAGG + Intronic
1188317418 X:28691581-28691603 CCAGACACTGATAGGAGCTATGG - Intronic
1189391953 X:40583828-40583850 CCAGCCACTGGGTGGAAGGAAGG + Intronic
1198870235 X:141171332-141171354 CCAGCCTCTGAGGGGAAAAAGGG + Intergenic
1199116857 X:144002679-144002701 CCTGCAACTGATTGGACAGAGGG - Intergenic
1199158385 X:144577182-144577204 CTGGCAACTGATTGGACATAAGG + Intergenic
1199972884 X:152873596-152873618 CCAGCAACTCATTGGCAATCTGG + Intergenic
1202370781 Y:24194151-24194173 CTAGCAACTGATTAGAAAGATGG + Intergenic
1202500003 Y:25475966-25475988 CTAGCAACTGATTAGAAAGATGG - Intergenic