ID: 1097175778

View in Genome Browser
Species Human (GRCh38)
Location 12:57142143-57142165
Sequence TTTCCCCCAAAGGGCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097175774_1097175778 -9 Left 1097175774 12:57142129-57142151 CCAGCTCTACAGTCTTTCCCCCA 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1097175772_1097175778 11 Left 1097175772 12:57142109-57142131 CCAGCCTGTGGCTCAGGTCACCA 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1097175773_1097175778 7 Left 1097175773 12:57142113-57142135 CCTGTGGCTCAGGTCACCAGCTC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097175778 Original CRISPR TTTCCCCCAAAGGGCCCTGT GGG Intronic
903253933 1:22079089-22079111 TGACCCCCAAAGGACTCTGTTGG - Intronic
905698791 1:39996162-39996184 CTTGCACCAAGGGGCCCTGTGGG - Intergenic
907094624 1:51766467-51766489 TTCCCCCAAAAGTTCCCTGTGGG - Intronic
908868342 1:68577669-68577691 TTTCCCCCAAGGGATCCTATGGG - Intergenic
910318041 1:85911423-85911445 TTTTCCTAAAAGGGACCTGTTGG - Exonic
910508276 1:87975438-87975460 TTTCCCCTGAGTGGCCCTGTAGG + Intergenic
913699190 1:121357666-121357688 ATTCCTCCAATGGGCTCTGTGGG - Intronic
914138355 1:144922379-144922401 ATTCCTCCAATGGGCTCTGTGGG + Intronic
914807419 1:151001814-151001836 TTTCCTCCAAAGAGCACTGAAGG + Intronic
916000261 1:160608439-160608461 TTTCCCCCAAATGGCACTATGGG - Exonic
916036551 1:160927593-160927615 TTTCCACCATATAGCCCTGTTGG - Intergenic
916290760 1:163163969-163163991 TTTTTCCCAAATGGCCTTGTTGG + Intronic
917910098 1:179634897-179634919 TTTCCCTCTAAAGCCCCTGTGGG - Intronic
920486600 1:206376378-206376400 ATTCCTCCAATGGGCTCTGTGGG - Intronic
921615689 1:217264185-217264207 CTTCCTCCAAACGGCCCTGCAGG + Intergenic
922089508 1:222382350-222382372 CATCCCACAAAGGGCCATGTGGG + Intergenic
1066790819 10:39061369-39061391 TTATCCCCATAGGACCCTGTGGG + Intergenic
1066790886 10:39062055-39062077 TTTTCCCCACAGGCCCCAGTGGG + Intergenic
1066791032 10:39063909-39063931 TTTACCCCATAGGCCTCTGTGGG + Intergenic
1066791125 10:39064953-39064975 TTATCCCCATAGGCCCCTGTGGG + Intergenic
1066929430 10:41738429-41738451 TTTCCCCCAAAGGTCTCAATAGG - Intergenic
1069590758 10:69640340-69640362 TTTTCACTAATGGGCCCTGTAGG - Intergenic
1069594950 10:69664428-69664450 TGTACCCCATGGGGCCCTGTGGG - Intergenic
1070650714 10:78233648-78233670 CTTCCCCCAAAGTGCCCAGAGGG - Intergenic
1073150187 10:101306069-101306091 ACTCCCCCAGAGGGCCCTGGAGG - Intergenic
1073789445 10:106925274-106925296 TGGCCCACAAAGGGCCCTGGAGG - Intronic
1074165246 10:110869274-110869296 TTGCCCCCAAAGGACCCATTAGG - Intergenic
1075414855 10:122255207-122255229 GTTCCCCCAAGAGGCTCTGTGGG + Intergenic
1076787671 10:132759193-132759215 TGTCCCCCTAAGGACACTGTTGG - Intronic
1078173963 11:8954816-8954838 TTCCCCCCAAAAGGCCCTGTGGG - Intronic
1080523578 11:33090016-33090038 ATTCCCCCAAAGGCCACTGAAGG + Intronic
1080861748 11:36155929-36155951 TTTCCTCCACAGAGCCCTGCAGG - Intronic
1082969075 11:59000101-59000123 TTAGCCCCAAATGGCCCTGATGG - Intronic
1083307503 11:61769012-61769034 CTGCCCCCCAAGTGCCCTGTAGG + Intronic
1085510553 11:77086008-77086030 TTTTGCCCAAAGGGCCAGGTGGG + Intronic
1088904529 11:114144295-114144317 TTTCACACAAAGCTCCCTGTTGG + Intronic
1089861547 11:121594669-121594691 TTTCCTCCAAATGGCCTTTTTGG + Intronic
1090931971 11:131305903-131305925 TTTCCCTCTGAGGGGCCTGTAGG + Intergenic
1091220450 11:133927309-133927331 TTTCTACCAAAGGGGCCTTTAGG + Intronic
1091675230 12:2484424-2484446 TGTGCCCTACAGGGCCCTGTCGG - Intronic
1094487988 12:30940058-30940080 AGACTCCCAAAGGGCCCTGTTGG + Intronic
1096183597 12:49564646-49564668 TGCCACCCACAGGGCCCTGTTGG + Intronic
1096183600 12:49564651-49564673 TTAGCCCAACAGGGCCCTGTGGG - Intronic
1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG + Intronic
1104795107 12:131511790-131511812 TATTCCCTAAAGGGCCCTGCAGG + Intergenic
1106949594 13:34868284-34868306 TCTCCCCCAAAGCTTCCTGTGGG - Intergenic
1112370398 13:98788382-98788404 TGACCCCCAGAGGGCCCTGGTGG - Intergenic
1113508399 13:110832290-110832312 TATCACCCAAGGGGCTCTGTGGG + Intergenic
1115431422 14:33323168-33323190 ATTCACCCAAAGGCCCCTCTGGG + Intronic
1118679845 14:68229374-68229396 TTATCCACAAAGGGCCCTCTAGG - Intronic
1119739211 14:77003246-77003268 GTTTCACCAAAGGGCCATGTAGG - Intergenic
1122721133 14:103723305-103723327 TTGCCCTCAAATGGGCCTGTCGG - Intronic
1202851166 14_GL000225v1_random:20858-20880 TTTCTCACAAAGCCCCCTGTAGG + Intergenic
1125535183 15:40438319-40438341 TGTCCCCCAAAGGGAACTTTTGG - Intergenic
1126305235 15:47248442-47248464 TTTACCCCAAAGTGCCCAGAAGG + Intronic
1129154317 15:73708352-73708374 ATTCCCCCCAGAGGCCCTGTGGG + Exonic
1129598119 15:76980682-76980704 TTTCCCCCAAAGGACATTATTGG + Intergenic
1131305021 15:91234794-91234816 TGTTCCCCAAAGAGACCTGTGGG + Intronic
1133349645 16:5093091-5093113 GTTGCCCCACAGGCCCCTGTTGG - Intronic
1135525272 16:23209344-23209366 TTTCCGAAAAAGGGACCTGTTGG - Intronic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1137742158 16:50789286-50789308 TTTCTCCCAAAGTGCCTTCTAGG - Intronic
1138423777 16:56916822-56916844 TTTCACCCAATGGGCTCTCTGGG + Intergenic
1141163427 16:81644472-81644494 TTACCCCCAAACTGCCCTTTTGG - Intronic
1141316708 16:82969198-82969220 TTTCCTGCAAAGGGCCAGGTAGG + Intronic
1144038104 17:11385382-11385404 TTGACCCCACAGGGCCCTGTGGG + Intronic
1144038107 17:11385387-11385409 AATGCCCCACAGGGCCCTGTGGG - Intronic
1144656565 17:17041139-17041161 TTTCCTCAAAAGGGAGCTGTGGG - Intergenic
1146213094 17:30957118-30957140 TTTCCCCCAAGGGGCTGTGCGGG - Intronic
1146464522 17:33075651-33075673 TTTCCCCCAGAAGGCCTGGTGGG - Intronic
1146907502 17:36627204-36627226 TTTCCCCCAAAAGGGGCTGAAGG - Intergenic
1147282696 17:39375790-39375812 TTTACCCCAAATGTGCCTGTTGG + Intronic
1148605599 17:48926957-48926979 TCTCTCCAAAAGGGTCCTGTGGG - Exonic
1149380340 17:56087275-56087297 TTGCCCCAGAAGGGCACTGTGGG + Intergenic
1152104126 17:78318979-78319001 TCCCCACCAAAGGGCCATGTGGG + Intergenic
1152363317 17:79842258-79842280 TTTCCCAGGAAGGGCCCTCTGGG - Intergenic
1152671475 17:81610233-81610255 ATTTCCCCAAAGGGCCGTGGCGG + Exonic
1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG + Intronic
1153473679 18:5473367-5473389 GTTTCCCCAAAAAGCCCTGTTGG - Intronic
1155289080 18:24322627-24322649 ATTTCTCCAAAGTGCCCTGTAGG - Intronic
1161435775 19:4261987-4262009 TTCCTCCAACAGGGCCCTGTGGG - Exonic
1161762191 19:6182256-6182278 TCTCCCCCAAAGAGACCTATAGG - Intronic
1164333062 19:24279371-24279393 TTTTCACCATAGGCCCCTGTGGG + Intergenic
1164767204 19:30781207-30781229 CATCCCTCAAAGGGCTCTGTGGG - Intergenic
1166164429 19:40977411-40977433 TTTCCCCCGATGGACCCTCTGGG + Intergenic
1166319071 19:42005420-42005442 TCTTCCCCCAAGGGCCCTGTGGG - Intronic
1168216331 19:54928765-54928787 GATCCCCCATAAGGCCCTGTAGG + Intronic
925845943 2:8033679-8033701 TTCCCTCCACACGGCCCTGTGGG + Intergenic
937914719 2:127093161-127093183 TGGCCCCCACAAGGCCCTGTCGG + Intronic
940400305 2:153241291-153241313 TTTCTCCCATTGGTCCCTGTTGG - Intergenic
944605875 2:201351027-201351049 TTCCAACCAAAGGGCCCTGATGG - Intronic
945170302 2:206988638-206988660 TTTCCTCCACAGGGCCTGGTGGG + Intergenic
948726189 2:239935413-239935435 TGACCCCCACACGGCCCTGTCGG - Intronic
1169800229 20:9506615-9506637 TTTCCCGGAAAGAGCCCTGGGGG - Intergenic
1171101017 20:22384222-22384244 TCTCACCCCAAGGGCCCTCTTGG + Intergenic
1174708861 20:52684467-52684489 TTTCCCCTAAAGGGCCGTGGGGG + Intergenic
1174843055 20:53917760-53917782 TTTGTCCCAAAGGTCCCTGTAGG - Intergenic
1174883509 20:54306478-54306500 TTTCCCCCATACTGCCCTCTTGG - Intergenic
1175488818 20:59364961-59364983 GTTCAGCCAAAGGGCCCTCTGGG + Intergenic
1179504447 21:41831407-41831429 TTTGCCCCAAGGGACGCTGTCGG - Intronic
1179553637 21:42159174-42159196 TTTCCCCCATTGCACCCTGTGGG + Intergenic
1180593299 22:16958189-16958211 GTTCTCCCAAATGGCACTGTAGG - Intergenic
1180708386 22:17823329-17823351 CTTCCCCCAAAGGTTGCTGTAGG + Intronic
1182320787 22:29477624-29477646 GTTCCCCCAAAGGACCCTTCAGG - Intergenic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
951022734 3:17798305-17798327 TTACCCCCAAAGGTCAGTGTGGG - Intronic
954541634 3:51396754-51396776 TCTCCCCCACAGAGACCTGTGGG + Exonic
954700898 3:52450457-52450479 CTTCCAGCCAAGGGCCCTGTCGG - Intergenic
955053525 3:55435445-55435467 TTTCTCCCACAGTGCTCTGTGGG - Intergenic
955239097 3:57164476-57164498 TTTCCGCCAAAGGGCCGCGTGGG - Intronic
959524572 3:107362072-107362094 TTTGCTCCAAAGCTCCCTGTTGG + Intergenic
960281761 3:115788162-115788184 ATTCCCCCAAAGGCACGTGTTGG - Intergenic
961887627 3:130106816-130106838 GTTGCCCCACAGGCCCCTGTTGG - Intronic
963370469 3:144393248-144393270 TTTTCCCCCAAGGGTCCTCTAGG + Intergenic
967730029 3:192898911-192898933 TTTCCATCAAAGGCCTCTGTGGG + Intronic
968996757 4:3950746-3950768 GTTGCCCCACAGGCCCCTGTTGG - Intergenic
969851104 4:9956997-9957019 TTTGCCCCAAAGACCCCTGGTGG + Intronic
972293515 4:37714496-37714518 TGTCCCCCATAGGTCCCTGCAGG - Intergenic
976001054 4:80373371-80373393 TCTCCCCCAAAGAGACCTATGGG - Intronic
979008818 4:115340021-115340043 TTTCCCCCATAAGGCCATCTAGG + Intergenic
980724157 4:136736383-136736405 TTCCCACCAAAGGGATCTGTGGG + Intergenic
984978802 4:185257271-185257293 TTTCTCCCTTGGGGCCCTGTGGG + Intronic
995863251 5:116663096-116663118 TTTCCCTCAAAGGTCCCTAAAGG - Intergenic
998821060 5:146058394-146058416 TTTTCCACTAACGGCCCTGTGGG - Intronic
999240966 5:150127158-150127180 CTTCACCCAAAGGGCCCAGTTGG + Intronic
999625488 5:153516412-153516434 TTTCCCCCAAAGGGTGCTGTGGG - Intronic
999975776 5:156910629-156910651 TATGTGCCAAAGGGCCCTGTGGG - Intergenic
1002674620 5:180900801-180900823 GTTCCTCCAAAGGTCCCAGTGGG - Intronic
1002683777 5:180990869-180990891 GTTCCTCCAAAGGACCCAGTGGG - Intronic
1004193268 6:13483330-13483352 TTTCCTTGAATGGGCCCTGTTGG - Intronic
1006078197 6:31547830-31547852 TTTTCCCCATCCGGCCCTGTTGG + Intronic
1007831677 6:44643637-44643659 ATTCCCCCAAAGCCCCCTGGAGG + Intergenic
1010784341 6:79982861-79982883 TTTGCCCCAGAGGCACCTGTGGG + Intergenic
1012524419 6:100160304-100160326 TATGCCCCAAAGCTCCCTGTGGG - Intergenic
1015665560 6:135624556-135624578 TTTCCACCAAAGGGTTGTGTTGG + Intergenic
1017779791 6:157706919-157706941 TTTCTCCCCATGGGTCCTGTAGG + Intronic
1017951311 6:159137355-159137377 TGTCACCCTAAGGGCCCTATTGG - Intergenic
1018619401 6:165715506-165715528 ATTCCCCCAAAGGAACCTGTAGG + Intronic
1019152918 6:170020868-170020890 TTCTCCCCAAAGTGCCCTGTAGG + Intergenic
1020462050 7:8437108-8437130 TTTACCCCAAGGTGTCCTGTGGG - Intronic
1025534774 7:61934078-61934100 TTTTCCCCATAGGCCCCTATGGG - Intergenic
1025536540 7:61955463-61955485 TTTTCCCCAAAGGCCTCAGTGGG - Intergenic
1027231272 7:76274111-76274133 TTTGCCCGAAAGGGCCCTGAAGG - Intronic
1028620321 7:92819397-92819419 TTCACTGCAAAGGGCCCTGTGGG + Intronic
1029243052 7:99178098-99178120 TATCCCCCAAAGGCTCCTGCCGG - Intronic
1034781819 7:153888063-153888085 TTTCCCCAGAAGAGCCCTGGGGG - Intronic
1037436655 8:18870508-18870530 TATCACCCACCGGGCCCTGTCGG + Intronic
1046691554 8:117291212-117291234 TTTCCTCCAAAGAGGCCTATTGG - Intergenic
1047900106 8:129411487-129411509 TTTCCCCCAAAGAACTCTGCTGG + Intergenic
1049781808 8:144432534-144432556 TTTCCCCAAAGGGGTCCTGAGGG - Intronic
1055275014 9:74605394-74605416 ATTCCCCAAAAGGCCCCTGTTGG - Intronic
1057520604 9:95757107-95757129 TCTCTGCCAAAAGGCCCTGTAGG - Intergenic
1059530272 9:115029272-115029294 TCTCTCCCATAGGTCCCTGTGGG + Intronic
1060892376 9:127196990-127197012 TTTGCCCTGCAGGGCCCTGTGGG - Intronic
1062175056 9:135157116-135157138 CTCCTCCCAAATGGCCCTGTTGG + Intergenic
1186603255 X:11061157-11061179 TTTGCCCCAAAGTGACCTTTGGG + Intergenic
1189436109 X:40994246-40994268 CTTCCCAGAAAGGGCCCTTTTGG + Intergenic
1191577779 X:62725640-62725662 TTTCCCCCATAGGACCCAATTGG + Intergenic
1192808486 X:74530005-74530027 TTTTCCCAGAAGGGCACTGTTGG + Intronic
1197726514 X:129780569-129780591 TCTCACTCAAAGGGCCCTGCTGG + Intronic
1197726977 X:129782942-129782964 TTTCACCCAAAGGCCAGTGTTGG + Intronic
1199627899 X:149757781-149757803 TTTCCACCAATGTCCCCTGTGGG + Intergenic
1201777681 Y:17684388-17684410 TTTCCCCCAAAGGCCTCAATGGG + Intergenic
1201823877 Y:18221604-18221626 TTTCCCCCAAAGGCCTCAATGGG - Intergenic
1202624499 Y:56843493-56843515 TCTCTCACAAAGGCCCCTGTAGG - Intergenic